Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU062411

Sigma-Aldrich

MISSION® esiRNA

targeting human TRAF2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTTGGAGCAGAAGGTCTTGGAGATGGAGGCATCCACCTACGATGGGGTCTTCATCTGGAAGATCTCAGACTTCGCCAGGAAGCGCCAGGAAGCTGTGGCTGGCCGCATACCCGCCATCTTCTCCCCAGCCTTCTACACCAGCAGGTACGGCTACAAGATGTGTCTGCGTATCTACCTGAACGGCGACGGCACCGGGCGAGGAACACACCTGTCCCTCTTCTTTGTGGTGATGAAGGGCCCGAATGACGCCCTGCTGCGGTGGCCCTTCAACCAGAAGGTGACCTTAATGCTGCTCGACCAGAATAACCGGGAGCACGTGATTGACGCCTTCAGGCCCGACGTGACTTCATCCTCTTTTCAGAGGCCAGTCAACGACATGAACATCGCAAGCGGCTGCCCCCTCTTCTGCCCCGTCTCCAAGATGGAGGCAAAGAATTCCTACGTGCGGGACGATGCCATCTTCATCAAGGCCATT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hong Cheng et al.
The Journal of investigative dermatology, 135(10), 2427-2436 (2015-05-29)
Previously, tumor necrosis factor (TNF)-like weak inducer of apoptosis (TWEAK) had been known to be an inducer of apoptosis of keratinocytes by engaging the Fn14 receptor. However, the high-risk human papillomavirus (HPV) infection confers a proliferation advantage on keratinocytes that
I Karl et al.
Cell death & disease, 5, e1444-e1444 (2014-10-10)
The relevance of the adaptor protein TNF receptor-associated factor 2 (TRAF2) for signal transduction of the death receptor tumour necrosis factor receptor1 (TNFR1) is well-established. The role of TRAF2 for signalling by CD95 and the TNF-related apoptosis inducing ligand (TRAIL)
Alexey V Sorokin et al.
Cancer research, 75(9), 1846-1858 (2015-04-17)
The protein tyrosine phosphatase receptor PTPRN2 is expressed predominantly in endocrine and neuronal cells, where it functions in exocytosis. We found that its immature isoform proPTPRN2 is overexpressed in various cancers, including breast cancer. High proPTPRN2 expression was associated strongly

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique