Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU061621

Sigma-Aldrich

MISSION® esiRNA

targeting human PAX8

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGCAAGATCCTTGGCAGGTACTACGAGACTGGCAGCATCCGGCCTGGAGTGATAGGGGGCTCCAAGCCCAAGGTGGCCACCCCCAAGGTGGTGGAGAAGATTGGGGACTACAAACGCCAGAACCCTACCATGTTTGCCTGGGAGATCCGAGACCGGCTCCTGGCTGAGGGCGTCTGTGACAATGACACTGTGCCCAGTGTCAGCTCCATTAATAGAATCATCCGGACCAAAGTGCAGCAACCATTCAACCTCCCTATGGACAGCTGCGTGGCCACCAAGTCCCTGAGTCCCGGACACACGCTGATCCCCAGCTCAGCTGTAACTCCCCCGGAGTCACCCCAGTCGGATTCCCTGGGCTCCACCTACTCCATCAATGGGCTCCTGGGCATCGCTCAGCCTGGCAGCGACAAGAGGAAAATGGATGACAGTGATCAGGATAGCTGCCGACTAAGCATTGACTCACAGAGCAGCAGCAG

Numéro d'accès Ensembl | humain

ENSG00000125618

Numéro d'accès NCBI

NM_013992

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... PAX8(7849) , PAX8(7849)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hui Tong et al.
Aging, 12(1), 70-79 (2020-01-10)
Long noncoding RNAs play vital roles in several biological processes, including cell growth and embryonic development. We showed that MACC1-AS1 was overexpressed in hepatocellular carcinoma (HCC) cells and tissues. The MACC1-AS1 expression level was dramatically upregulated in HCC samples compared
Dima Ghannam-Shahbari et al.
Oncogene, 37(17), 2213-2224 (2018-01-31)
High grade serous carcinoma (HGSC) is the most common subtype of ovarian cancer and it is now widely accepted that this disease often originates from the fallopian tube epithelium. PAX8 is a fallopian tube lineage marker with an essential role
Laura R Hardy et al.
Oncogene, 38(32), 6003-6016 (2019-07-13)
High grade serous ovarian cancer (HGSOC) is the fifth leading cause of cancer deaths among women yet effective targeted therapies against this disease are limited. The heterogeneity of HGSOC, including few shared oncogenic drivers and origination from both the fallopian

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique