Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU059861

Sigma-Aldrich

MISSION® esiRNA

targeting human TP53I3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AATGCAGAGACAAGGCCAGTATGACCCACCTCCAGGAGCCAGCAACATTTTGGGACTTGAGGCATCTGGACATGTGGCAGAGCTGGGGCCTGGCTGCCAGGGACACTGGAAGATCGGGGACACAGCCATGGCTCTGCTCCCCGGTGGGGGCCAGGCTCAGTACGTCACTGTCCCCGAAGGGCTCCTCATGCCTATCCCAGAGGGATTGACCCTGACCCAGGCTGCAGCCATCCCAGAGGCCTGGCTCACCGCCTTCCAGCTGTTACATCTTGTGGGAAATGTTCAGGCTGGAGACTATGTGCTAATCCATGCAGGACTGAGTGGTGTGGGCACAGCTGCTATCCAACTCACCCGGATGGCTGGAGCTATTCCTCTGGTCACAGCTGGCTCCCAGAAGAAGCTTCAAATGGCAGAAAAGC

Numéro d'accès Ensembl | humain

ENSG00000115129

Numéro d'accès NCBI

NM_004881

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... TP53I3(9540) , TP53I3(9540)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Seon-Joo Park et al.
The Korean journal of physiology & pharmacology : official journal of the Korean Physiological Society and the Korean Society of Pharmacology, 21(2), 267-273 (2017-03-11)
The p53-inducible gene 3 (PIG3), initially identified as a gene downstream of p53, plays an important role in the apoptotic process triggered by p53-mediated reactive oxygen species (ROS) production. Recently, several studies have suggested that PIG3 may play a role
Min Jin et al.
Biomolecules & therapeutics, 25(4), 396-403 (2017-06-14)
Under normal, non-stressed conditions, intracellular p53 is continually ubiquitinated by MDM2 and targeted for degradation. However, in response to severe genotoxic stress, p53 protein levels are markedly increased and apoptotic cell death is triggered. Inhibiting the ubiquitination of p53 under

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique