Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU058661

Sigma-Aldrich

MISSION® esiRNA

targeting human ROBO2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCTCCTCCAGATCACCAGAATGGAATTATCCAAGAATACAAGATCTGGTGTCTAGGAAATGAAACGCGATTCCATATCAACAAAACTGTGGATGCAGCCATTCGGTCCGTAATAATTGGTGGATTATTCCCAGGTATTCAATACCGGGTAGAGGTTGCAGCTAGTACCAGTGCAGGGGTTGGAGTAAAGAGTGAGCCACAGCCAATAATAATCGGGAGACGCAATGAAGTTGTCATTACTGAAAACAATAACAGCATAACTGAGCAAATCACTGATGTGGTGAAGCAACCAGCCTTTATAGCTGGTATTGGTGGTGCCTGCTGGGTAATTCTGATGGGTTTTAGCATATGGTTGTATTGGCGAAGAAAGAAGAGGAAGGGACTCAGTAATTATGCTGTTACGTTTCAAAGAGGAGATGGAGGACTAATGAGCAATGGAAGCCGT

Numéro d'accès Ensembl | humain

ENSG00000185008

Numéro d'accès NCBI

NM_002942

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ROBO2(6092) , ROBO2(6092)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Tian-Ping Chen et al.
Molecular medicine (Cambridge, Mass.), 27(1), 21-21 (2021-03-05)
Studies have found that circular RNAs (circRNAs) play key roles in cardiovascular diseases. However, the function of circROBO2 in acute myocardial infarction (AMI) is unclear. This study aimed to investigate the pathogenesis of circROBO2 in AMI. qRT-PCR and Western blot
Zhiping Zeng et al.
Life sciences, 203, 39-47 (2018-04-17)
Slit/Robo signaling was originally identified as a repulsive guidance cue in regulating axon branching and neuronal migration. Hepatic stellate cells (HSCs) are the key fibrogenic cells in the liver, which are migratory when activated, and express neural crest markers. The
Gael Genet et al.
Nature communications, 10(1), 2350-2350 (2019-05-30)
Endothelial cell migration, proliferation and survival are triggered by VEGF-A activation of VEGFR2. However, how these cell behaviors are regulated individually is still unknown. Here we identify Endophilin-A2 (ENDOA2), a BAR-domain protein that orchestrates CLATHRIN-independent internalization, as a critical mediator
Feng Zhang et al.
Nature communications, 7, 13517-13517 (2016-11-25)
Vascular permeability and neovascularization are implicated in many diseases including retinopathies and diabetic wound healing. Robo4 is an endothelial-specific transmembrane receptor that stabilizes the vasculature, as shown in Robo4

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique