Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU056051

Sigma-Aldrich

MISSION® esiRNA

targeting human SPTA1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCTTGTTGCCTCTGAAGGACTGTTTCACAGTCACAAGGGACTTGAGAGAAATCTTGCTGTCATGAGTGACAAGGTGAAGGAGTTATGTGCTAAAGCAGAGAAGCTGACACTTTCCCATCCTTCAGATGCACCTCAGATCCAGGAGATGAAAGAAGATCTGGTCTCCAGCTGGGAGCATATTCGTGCCCTGGCCACCAGCAGATATGAAAAACTGCAGGCTACTTATTGGTACCATCGATTTTCATCTGACTTTGATGAACTCTCAGGCTGGATGAACGAGAAGACTGCTGCGATCAATGCTGATGAGCTGCCAACAGATGTGGCTGGTGGAGAAGTTCTGCTGGACAGGCATCAGCAGCATAAGCATGAGATTGACTCTTACGATGACCGATTTCAATCTGCTGATGAGACTGGTCAAGACCTCGTGAATGCCAATCATGAAGCCTC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

N C Hait et al.
Oncogenesis, 4, e156-e156 (2015-06-09)
Estrogen receptor-α (ERα)-negative breast cancer is clinically aggressive and does not respond to conventional hormonal therapies. Strategies that lead to re-expression of ERα could sensitize ERα-negative breast cancers to selective ER modulators. FTY720 (fingolimod, Gilenya), a sphingosine analog, is the
T H Beckham et al.
Oncogenesis, 2, e49-e49 (2013-06-05)
Acid ceramidase (AC) is overexpressed in most prostate tumors and confers oncogenic phenotypes to prostate cancer cells. AC modulates the cellular balance between ceramide, sphingosine and sphingosine 1-phosphate (S1P). These bioactive sphingolipids have diverse, powerful and often oppositional impacts on
Evgeny V Berdyshev et al.
PloS one, 6(1), e16571-e16571 (2011-02-10)
Earlier we have shown that extracellular sphingosine-1-phosphate (S1P) induces migration of human pulmonary artery endothelial cells (HPAECs) through the activation of S1P(1) receptor, PKCε, and PLD2-PKCζ-Rac1 signaling cascade. As endothelial cells generate intracellular S1P, here we have investigated the role
Yunze Xu et al.
Oncotarget, 7(3), 3233-3244 (2015-12-18)
Adrenocortical carcinoma (ACC) is a rare endocrine tumor with a very poor prognosis. Sphingosine kinase 1 (SphK1), an oncogenic kinase, has previously been found to be upregulated in various cancers. However, the role of the SphK1 in ACC has not
Panfeng Fu et al.
The Journal of biological chemistry, 291(53), 27187-27203 (2016-11-20)
Hepatocyte growth factor (HGF) signaling via c-Met is known to promote endothelial cell motility and angiogenesis. We have previously reported that HGF stimulates lamellipodia formation and motility of human lung microvascular endothelial cells (HLMVECs) via PI3K/Akt signal transduction and reactive

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique