Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU055151

Sigma-Aldrich

MISSION® esiRNA

targeting human INO80D

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTGAAGAGAGCGGAGAGGAACCAGAGGACTCAGAGCAGGCCTCGCCCTACCAGGTTGCATGGTCCATCCGGGAAACCCTCAGATATCAAAGACATGCGTCAGATGATGATGATGCGGAGAGTAGGAGCTCCAGGGTGACTCAACTTTGCACTTACTTTCAGCAGAAATATAAGCACCTCTGCCGCCTGGAGCGGGCAGAATCTCGTCAAAAGAAATGCCGGCATACGTTTAGGAAAGCTTTGCTGCAGGCGGCCAGTAAAGAACCAGAATGCACTGGTCAGTTAATACAAGAACTGCGGAGAGCTGCATGCAGTCGAACCAGCATAAGCCGGACCAAGCTGAGGGAGGTGGAACCAGCAGCATGCAGTGGAACCGTGAAGGGTGAACAGTGCGCTAACAA

Numéro d'accès Ensembl | humain

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Chun-Chi Chang et al.
International journal of oncology, 53(1), 417-433 (2018-05-12)
Long non‑coding RNAs (lncRNAs) have various functions, including chromatin remodeling and the regulation of gene expression at the transcriptional and post-transcriptional levels. However, few lncRNAs have been investigated comprehensively, with the majority being uncharacterized. In the present study, a bioinformatics
Gabriel G Malouf et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(15), 4129-4140 (2014-06-06)
MITF/TFE translocation renal cell carcinoma (TRCC) is a rare subtype of kidney cancer. Its incidence and the genome-wide characterization of its genetic origin have not been fully elucidated. We performed RNA and exome sequencing on an exploratory set of TRCC

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique