Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU054581

Sigma-Aldrich

MISSION® esiRNA

targeting human SND1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCCATTGTTGTGAAGCTGAACTCAGGCGATTACAAGACGATTCACCTGTCCAGCATCCGACCACCGAGGCTGGAGGGGGAGAACACCCAGGATAAGAACAAGAAACTGCGTCCCCTGTATGACATTCCTTACATGTTTGAGGCCCGGGAATTTCTTCGAAAAAAGCTTATTGGGAAGAAGGTCAATGTGACGGTGGACTACATTAGACCAGCCAGCCCAGCCACAGAGACAGTGCCTGCCTTTTCAGAGCGTACCTGTGCCACTGTCACCATTGGAGGAATAAACATTGCTGAGGCTCTTGTCAGCAAAGGTCTAGCCACAGTGATCAGATACCGGCAGGATGATGACCAGAGATCATCACACTACGATGAACTGCTTGCTGCAGAGGCCAGAGCTATTAAGAATGGCAAAGGATTGCATAGCAAGAAGGAAGTGCCTATCCACCGTGT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

12 - Non Combustible Liquids

Classe de danger pour l'eau (WGK)

WGK 1

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Huining Li et al.
Oncotarget, 8(12), 19723-19737 (2017-02-06)
miR-320a downexpression contributes to tumorigenesis in several human cancers. However, the relevance of miR-320a to prognosis, proliferation and invasion in gliomas remains unclear. In this study, we demonstrated that miR-320a expression was decreased in human glioma tissues and cell lines.
Yongqiang Zhang et al.
Oncology letters, 15(6), 9553-9558 (2018-05-29)
Glioma is one of the malignant tumor types detrimental to human health; therefore, it is important to find novel targets and therapeutics for this tumor. The downregulated expression of Tudor-staphylococcal nuclease (SN) and alkylglycerone phosphate synthase (AGPS) can decrease cancer
Fei Ma et al.
Oncotarget, 6(19), 17404-17416 (2015-05-13)
MicroRNAs (miRs) function as key regulators of gene expression and their deregulation is associated with the carcinogenesis of various cancers. In the present study, we investigated the biological role and mechanism of miR-361-5p in colorectal carcinoma (CRC) and gastric cancer

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique