Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU054511

Sigma-Aldrich

MISSION® esiRNA

targeting human IGFBP2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AAGCATGGCCTGTACAACCTCAAACAGTGCAAGATGTCTCTGAACGGGCAGCGTGGGGAGTGCTGGTGTGTGAACCCCAACACCGGGAAGCTGATCCAGGGAGCCCCCACCATCCGGGGGGACCCCGAGTGTCATCTCTTCTACAATGAGCAGCAGGAGGCTCGCGGGGTGCACACCCAGCGGATGCAGTAGACCGCAGCCAGCCGGTGCCTGGCGCCCCTGCCCCCCGCCCCTCTCCAAACACCGGCAGAAAACGGAGAGTGCTTGGGTGGTGGGTGCTGGAGGATTTTCCAGTTCTGACACACGTATTTATATTTGGAAAGAGACCAGCACCGAGCTCGGCACCTCCCCGGCCTCTCTCTTCCCAGCTGCAGATGCCACACCTGCTCCTTCTTGCTTT

Numéro d'accès Ensembl | humain

ENSG00000115457

Numéro d'accès NCBI

NM_000597

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... IGFBP2(3485) , IGFBP2(3485)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Z-S Yuan et al.
European review for medical and pharmacological sciences, 21(22), 5072-5080 (2017-12-12)
Gliomas are accompanied with high mortality owning to their invasive peculiarity and vulnerability to drug resistance. miR-21 is a vital oncogenic miRNA that regulates drug resistance of tumor cells. This study aims to elucidate the function of miR-21 in human
Hiromichi Katayama et al.
Scientific reports, 7(1), 12016-12016 (2017-09-22)
Renal cell carcinoma (RCC) is one of the most lethal urologic cancers. About one-third of RCC patients already have distal metastasis at the time of diagnosis. There is growing evidence that Hox antisense intergenic RNA (HOTAIR) plays essential roles in
S W Yau et al.
International journal of obesity (2005), 39(5), 770-781 (2014-11-06)
IGF-binding protein (IGFBP)-2 is the principal IGFBP produced by white adipocytes during adipogenesis, and circulating levels are reduced in obesity. Overexpression of IGFBP-2 in transgenic mice prevents obesity, but depot-specific effects of IGFBP-2 on adipo/lipogenesis are unknown. The present study
Steven W Yau et al.
Endocrinology, 155(6), 2133-2143 (2014-03-25)
Leptin is produced from white adipose tissue and acts primarily to regulate energy balance. Obesity is associated with leptin resistance and increased circulating levels of leptin. Leptin has recently been shown to influence levels of IGF binding protein-2 (IGFBP-2), a

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique