Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU050541

Sigma-Aldrich

MISSION® esiRNA

targeting human FSCN1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACCTGTCTGCCAATCAGGACGAGGAGACCGACCAGGAGACCTTCCAGCTGGAGATCGACCGCGACACCAAAAAGTGTGCCTTCCGTACCCACACGGGCAAGTACTGGACGCTGACGGCCACCGGGGGCGTGCAGTCCACCGCCTCCAGCAAGAATGCCAGCTGCTACTTTGACATCGAGTGGCGTGACCGGCGCATCACACTGAGGGCGTCCAATGGCAAGTTTGTGACCTCCAAGAAGAATGGGCAGCTGGCCGCCTCGGTGGAGACAGCAGGGGACTCAGAGCTCTTCCTCATGAAGCTCATCAACCGCCCCATCATCGTGTTCCGCGGGGAGCATGGCTTCATCGGCTGCCGCAAGGTCACGGGCACCCTGGACGCCAACCGCTCCAGCTATGACGTCTTCCAGCTGGAGTTCAACGATGGCGCCTACAACATCAAAGACTCCACAGGCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Wei Gao et al.
Molecular therapy : the journal of the American Society of Gene Therapy, 27(2), 365-379 (2018-10-21)
Laryngeal squamous cell carcinoma (LSCC) is a common form of head and neck cancer with poor prognosis. However, the mechanism underlying the pathogenesis of LSCC remains unclear. Here, we demonstrated increased expression of fascin actin-bundling protein 1 (FSCN1) and decreased
Priscila Campioni Rodrigues et al.
Oncotarget, 8(43), 74736-74754 (2017-11-02)
Oral squamous cell carcinoma (OSCC) prognosis is related to clinical stage and histological grade. However, this stratification needs to be refined. We conducted a comparative proteome study in microdissected samples from normal oral mucosa and OSCC to identify biomarkers for
Aihua Luo et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 73, 75-79 (2015-07-28)
Fascin actin-bundling protein 1 (FSCN1) plays significant roles in biological processes such as tumor cell invasion and metastasis. However, little is known about prognostic value of FSCN1 in non-small cell lung cancer (NSCLC). FSCN1 mRNA and protein expression were detected
Sean McGuire et al.
Gynecologic oncology, 153(2), 405-415 (2019-02-25)
Ovarian cancer (OvCa) metastasis requires the coordinated motility of both cancer and stromal cells. Cellular movement is a dynamic process that involves the synchronized assembly of f-actin bundles into cytoskeletal protrusions by fascin. Fascin directly binds f-actin and is an
Jia-jia Chen et al.
PloS one, 10(5), e0126890-e0126890 (2015-05-27)
MicroRNAs (miRs) play important roles in modulating gene expression during the processes of tumorigenesis and tumor development. Previous studies have found that miR-145 is down-regulated in the stomach neoplasm and is related to tumor migration and invasion. However, both the

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique