Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU050101

Sigma-Aldrich

MISSION® esiRNA

targeting human PARP1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CACTCATGCAACCACACACAATGCGTATGACTTGGAAGTCATCGATATCTTTAAGATAGAGCGTGAAGGCGAATGCCAGCGTTACAAGCCCTTTAAGCAGCTTCATAACCGAAGATTGCTGTGGCACGGGTCCAGGACCACCAACTTTGCTGGGATCCTGTCCCAGGGTCTTCGGATAGCCCCGCCTGAAGCGCCCGTGACAGGCTACATGTTTGGTAAAGGGATCTATTTCGCTGACATGGTCTCCAAGAGTGCCAACTACTGCCATACGTCTCAGGGAGACCCAATAGGCTTAATCCTGTTGGGAGAAGTTGCCCTTGGAAACATGTATGAACTGAAGCACGCTTCACATATCAGCAAGTTACCCAAGGGCAAGCACAGTGTCAAAGGTTTGGGCAAAAC

Numéro d'accès Ensembl | humain

ENSG00000143799

Numéro d'accès NCBI

NM_001618

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... PARP1(142) , PARP1(142)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Monica E Wielgos et al.
Molecular cancer therapeutics, 17(5), 921-930 (2018-03-30)
HER2-targeted therapies, such as trastuzumab, have increased the survival rates of HER2+ breast cancer patients. However, despite these therapies, many tumors eventually develop resistance to these therapies. Our lab previously reported an unexpected sensitivity of HER2+ breast cancer cells to
Hogyoung Kim et al.
Journal of translational medicine, 13, 233-233 (2015-07-18)
We and others have extensively investigated the role of PARP-1 in cell growth and demise in response to pathophysiological cues. Most of the clinical trials on PARP inhibitors are targeting primarily estrogen receptor (ER) negative cancers with BRCA-deficiency. It is
Zhuoyu Gu et al.
Journal of hematology & oncology, 11(1), 115-115 (2018-09-16)
Recently, many potential prognostic biomarkers for gastric cancer (GC) have been identified, but the prognosis of advanced GC patients remains poor. Chloride channels are promising cancer biomarkers, and their family member chloride channel-3 (CLC-3) is involved in multiple biological behaviors.
Manish Mishra et al.
Biochimica et biophysica acta, 1863(7), 1761-1769 (2017-05-10)
In diabetes, matrix metalloproteinase-9 (MMP-9) is activated, which damages mitochondria, resulting in accelerated capillary cell apoptosis. Regulation of MMP-9 is controlled by multiple transcription factors including nuclear factor-kB (NF-kB) and activator protein-1 (AP-1). Binding of these transcription factors, however, can
Qianghua Xia et al.
Diabetologia, 59(11), 2360-2368 (2016-08-20)
One of the most strongly associated type 2 diabetes loci reported to date resides within the TCF7L2 gene. Previous studies point to the T allele of rs7903146 in intron 3 as the causal variant at this locus. We aimed to
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique