Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU049691

Sigma-Aldrich

MISSION® esiRNA

targeting human GLRA1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGGACTAACTCTGCCCCAGTTTATCTTGAAGGAAGAGAAGGACTTGAGATACTGCACCAAGCACTACAACACAGGTAAATTCACCTGCATTGAGGCCCGGTTCCACCTGGAGCGGCAGATGGGTTACTACCTGATTCAGATGTATATTCCCAGCCTGCTCATTGTCATCCTCTCATGGATCTCCTTCTGGATCAACATGGATGCTGCACCTGCTCGTGTGGGCCTAGGCATCACCACTGTGCTCACCATGACCACCCAGAGCTCCGGCTCTCGAGCATCTCTGCCCAAGGTGTCCTATGTGAAAGCCATTGACATTTGGATGGCAGTTTGCCTGCTCTTTGTGTTCTCAGCCCTATTAGAATATGCTGCCGTTAACTTTGTGTCTCGGCAACATAAGGAGCT

Numéro d'accès Ensembl | humain

ENSG00000145888

Numéro d'accès NCBI

NM_000171

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... GLRA1(2741) , GLRA1(2741)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Monica Agnoletti et al.
European journal of pharmaceutics and biopharmaceutics : official journal of Arbeitsgemeinschaft fur Pharmazeutische Verfahrenstechnik e.V, 120, 9-21 (2017-08-07)
Medicines based on small interfering RNA (siRNA) are promising for the treatment of a number of lung diseases. However, efficient delivery systems and design of stable dosage forms are required for inhalation therapy, as well as cost-effective methods for manufacturing
Jiaguo Wu et al.
Biochemical and biophysical research communications, 452(3), 554-559 (2014-08-31)
NF-E2 P45-related factor 2 (Nrf2) is a key transcription factor that controls genes encoding cytoprotective and detoxifying enzymes through antioxidant response elements (AREs) in their regulatory regions. We reported recently that retinoid X receptor alpha (RXRα) inhibits Nrf2 function by

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique