Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU047891

Sigma-Aldrich

MISSION® esiRNA

targeting human SIRT4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGAGCGTTTCCAAGTCCTGAACCCCACCTGGAGTGCTGAGGCCCATGGCCTGGCTCCTGATGGTGACGTCTTTCTCTCAGAGGAGCAAGTCCGGAGCTTTCAGGTCCCAACCTGCGTTCAATGTGGAGGCCATCTGAAACCAGATGTCGTTTTCTTCGGGGACACAGTGAACCCTGACAAGGTTGATTTTGTGCACAAGCGTGTAAAAGAAGCCGACTCCCTCTTGGTGGTGGGATCATCCTTGCAGGTATACTCTGGTTACAGGTTTATCCTCACTGCCTGGGAGAAGAAGCTCCCGATTGCAATACTGAACATTGGGCCCACACGGTCGGATGACTTGGCGTGTCTGAAACTGAATTCTCGTTGTGGAGAGTTGCTGCCTTTGATAGACCCATGCTGACCA

Numéro d'accès Ensembl | humain

ENSG00000089163

Numéro d'accès NCBI

NM_012240

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SIRT4(23409) , SIRT4(23409)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hongjie Sun et al.
OncoTargets and therapy, 11, 3959-3968 (2018-07-20)
Previous study has proven that SIRT4 is downregulated in gastric cancer (GC), but the role of SIRT4 has not been clearly understood. The aim of our work was to explore in detail the function and mechanism of SIRT4 in GC.
Ratana Lim et al.
Biology of reproduction, 95(5), 95-95 (2016-11-05)
Preterm birth remains the major cause of neonatal mortality and morbidity, mediated largely by an inflammatory process. The sirtuin (SIRT) family of cellular regulators has been implicated as key inhibitors of inflammation. We have previously reported a role for SIRT1
Peixin Huang et al.
Oncotarget, 6(13), 10812-10824 (2015-05-01)
Aging is the predominant risk factor for cardiovascular diseases and contributes to a considerably more severe outcome in patients with acute myocardial infarction. Resveratrol, a polyphenol found in red wine, is a caloric restriction mimetic with potential anti-aging properties which

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique