Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU046951

Sigma-Aldrich

MISSION® esiRNA

targeting human ARG2, VTI1B

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTCAGAGGAAGAGGCGAAGACTACAGCTAACCTGGCAGTAGATGTGATTGCTTCAAGCTTTGGTCAGACAAGAGAAGGAGGGCATATTGTCTATGACCAACTTCCTACTCCCAGTTCACCAGATGAATCAGAAAATCAAGCACGTGTGAGAATTTAGGAGACACTGTGCACTGACATGTTTCACAACAGGCATTCCAGAATTATGAGGCATTGAGGGGATAGATGAATACTAAATGGTTGTCTGGGTCAATACTGCCTTAATGAGAACATTTACACATTCTCACAATTGTAAAGTTTCCCCTCTATTTTGGTGACCAATACTACTGTAAATGTATTTGGTTTTTTGCAGTTCACAGGGTATTAATATGCTACAGTACTATGTAAATTTAAAGAAGTCATAAACAGCATTTATTACCTTGGTATATCATACTGGTCTTGTTGCTGTTGTTCCTTCACA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Bon-Hyeock Koo et al.
Experimental & molecular medicine, 51(6), 60-60 (2019-06-04)
Although arginase II (ArgII) is abundant in mitochondria, Ca2+-accumulating organelles, the relationship between ArgII activity and Ca2+ translocation into mitochondria and the regulation of cytosolic Ca2+ signaling are completely unknown. We investigated the effects of ArgII activity on mitochondrial Ca2+
Bon-Hyeock Koo et al.
Cells, 9(2) (2020-02-13)
Arginase II reciprocally regulates endothelial nitric oxide synthase (eNOS) through a p32-dependent Ca2+ control. We investigated the signaling pathway of arginase II-dependent eNOS phosphorylation. Western blot analysis was applied for examining protein activation and [Ca2+]c was analyzed by microscopic and
Kwanhoon Choi et al.
Molecular medicine reports, 22(3), 2395-2403 (2020-07-25)
The p32 protein plays a crucial role in the regulation of cytosolic Ca2+ concentrations ([Ca2+]c) that contributes to the Ca2+‑dependent signaling cascade. Using an adenovirus and plasmid p32‑overexpression system, the aim of the study was to evaluate the role of p32

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique