Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU045551

Sigma-Aldrich

MISSION® esiRNA

targeting human STK39

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCCACCCAATGCTAATGAAGACTACAGAGAAGCTTCTTCTTGTGCCGTGAACCTCGTTTTGAGATTAAGAAACTCCAGAAAGGAACTTAATGACATACGATTTGAGTTTACTCCAGGAAGAGATACAGCAGATGGTGTATCTCAGGAGCTCTTCTCTGCTGGCTTGGTGGATGGTCACGATGTAGTTATAGTGGCTGCTAATTTACAGAAGATTGTAGATGATCCCAAAGCTTTAAAAACATTGACATTTAAGTTGGCTTCTGGCTGTGATGGGTCGGAGATTCCTGATGAAGTGAAGCTGATTGGGTTTGCTCAGTTGAGTGTCAGCTGATGTATGTCCCTTGATGTCACCCTGATCTGTCATGCCCCACCGCCACCCCTACTCCCTTCAACCCTCCCTCTTTC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ken Yamada et al.
ACS chemical biology, 11(12), 3338-3346 (2016-10-08)
Protein kinases are known for their highly conserved adenosine triphosphate (ATP)-binding site, rendering the discovery of selective inhibitors a major challenge. In theory, allosteric inhibitors can achieve high selectivity by targeting less conserved regions of the kinases, often with an
Ye Bi et al.
Frontiers in physiology, 11, 638-638 (2020-07-28)
SPS1-related proline/alanine-rich kinase (SPAK) plays important roles in regulating the function of numerous ion channels and transporters. With-no-lysine (WNK) kinase phosphorylates SPAK kinase to active the SPAK signaling pathway. Our previous studies indicated that WNK kinases regulate the activity of
Xiuyan Feng et al.
American journal of physiology. Renal physiology, 308(10), F1119-F1127 (2015-03-13)
Thiazide-sensitive sodium chloride cotransporter (NCC) plays an important role in maintaining blood pressure. Aldosterone is known to modulate NCC abundance. Previous studies reported that dietary salts modulated NCC abundance through either WNK4 [with no lysine (k) kinase 4]-SPAK (Ste20-related proline

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique