Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU041711

Sigma-Aldrich

MISSION® esiRNA

targeting human CPT1A

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCACTGAGTCATGCGACTTCGTGCGGGCCATGGTGGACCCGGCCCAGACGGTGGAACAGAGGCTGAAGTTGTTCAAGTTGGCGTCTGAGAAGCATCAGCATATGTATCGCCTCGCCATGACCGGCTCTGGGATCGATCGTCACCTCTTCTGCCTTTACGTGGTGTCTAAATATCTCGCTGTGGAGTCCCCTTTCCTTAAGGAAGTTTTATCTGAGCCTTGGAGATTATCAACAAGCCAGACCCCTCAGCAGCAAGTGGAGCTGTTTGACTTGGAGAATAACCCAGAGTACGTGTCCAGCGGAGGGGGCTTTGGACCGGTTGCTGATGACGGCTATGGTGTGTCGTACATCCTTGTGGGAGAGAACCTCATCAATTTCCACATTTCTTCCAAGTTCTCTTGCCCTGAG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jin Seok et al.
Stem cell research & therapy, 11(1), 1-1 (2020-01-05)
Human placenta-derived mesenchymal stem cells (PD-MSCs) are powerful sources for cell therapy in regenerative medicine. However, a limited lifespan by senescence through mechanisms that are well unknown is the greatest obstacle. In the present study, we first demonstrated the characterization
Hideki Iwamoto et al.
Cell metabolism, 28(1), 104-117 (2018-06-05)
Intrinsic and evasive antiangiogenic drug (AAD) resistance is frequently developed in cancer patients, and molecular mechanisms underlying AAD resistance remain largely unknown. Here we describe AAD-triggered, lipid-dependent metabolic reprogramming as an alternative mechanism of AAD resistance. Unexpectedly, tumor angiogenesis in adipose
Seher Balaban et al.
Molecular cancer research : MCR, 17(4), 949-962 (2019-01-17)
Prostate cancer cells exhibit altered cellular metabolism but, notably, not the hallmarks of Warburg metabolism. Prostate cancer cells exhibit increased de novo synthesis of fatty acids (FA); however, little is known about how extracellular FAs, such as those in the
Trang Thi Thu Nguyen et al.
The Journal of clinical investigation, 130(7), 3699-3716 (2020-04-22)
The Warburg effect is a tumor-related phenomenon that could potentially be targeted therapeutically. Here, we showed that glioblastoma (GBM) cultures and patients' tumors harbored super-enhancers in several genes related to the Warburg effect. By conducting a transcriptome analysis followed by

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique