Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU041431

Sigma-Aldrich

MISSION® esiRNA

targeting human AQP4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCATGTGATTGACGTTGACCGGGGAGAGGAGAAGAAGGGGAAAGACCAATCTGGAGAGGTATTGTCTTCAGTATGACTAGAAGATCGCACTGAAAGCAGACAAGACTCCTTAGAACTGTCCTCAGATTTCCTTCCACCCATTAAGGAAACAGATTTGTTATAAATTAGAAATGTGCAGGTTTGTTGTTTCATGTCATATTACTCAGTCTAAACAATAAATATTTCATAATTTACAAAGGAGGAACGGAAGAAACCTATTGTGAATTCCAAATCTAAAAAAAGAAATATTTTTAAAATGTTCTTAAGCAAATATATACCTATTTTATCTAGTTACCTTTCATTAACAACCAATTTTAACCGTGTGTCAAGATTTGGTTAAGTCTTGCCTGACAGAACTCAAAGACACG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Chao Yang et al.
IUBMB life, 67(3), 182-190 (2015-04-11)
Emerging evidence indicates that the water channel protein aquaporin 4 (AQP4) plays an essential role in water homeostasis and is implicated in the pathogenesis of brain edema. This study aimed to understand the physiological role of AQP4 in hypoxia-ischemia-mediated cytotoxic
Letizia Granieri et al.
PloS one, 7(6), e38896-e38896 (2012-06-22)
Neuromyelitis optica (NMO) is a severely disabling autoimmune disorder of the central nervous system, which predominantly affects the optic nerves and spinal cord. In a majority of cases, NMO is associated with antibodies to aquaporin-4 (AQP4) (termed NMO-IgG). In this
Yusi Cheng et al.
Clinical and experimental pharmacology & physiology, 44(11), 1106-1115 (2017-07-09)
Aquaporin 4 (AQP4) is a type of water channel protein that maintains the water balance of cardiomyocytes. However, the physiological role of AQP4 in cardiovascular disease is poorly understood. We wanted to explore whether p66Shc and endoplasmic reticulum stress participates
Ya-Nan Li et al.
Medicine, 98(42), e17591-e17591 (2019-10-19)
Spinal cord ischemia-reperfusion injury (SCII) is a common complication of spinal surgery as well as thoracic and abdominal surgery. Acute cytotoxic edema is the key pathogenic alteration. Therefore, avoiding or decreasing cellular edema has become the major target for SCII
Dongfeng Niu et al.
PloS one, 7(7), e40770-e40770 (2012-07-19)
Aquaporin3 (AQP3) and Aquaporin4 (AQP4) play a major role in transcellular and transepithelial water movement as water channel membrane proteins. Little is known of their expression and significance in human thyroid tissues. Thus, we examined the expression of AQP3 and

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique