Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU039451

Sigma-Aldrich

MISSION® esiRNA

targeting human FBXL7

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CACCTGGATGTGTCAGGATGCTCCAAAGTGACCTGCATCAGCTTGACCCGGGAGGCCTCCATTAAACTGTCACCCTTGCATGGCAAACAGATTTCCATCCGCTACCTGGACATGACGGACTGCTTCGTGCTGGAGGACGAAGGCCTGCACACCATCGCGGCGCACTGCACGCAGCTCACCCACCTCTACCTGCGCCGCTGCGTCCGCCTGACCGACGAAGGCCTGCGCTACCTGGTGATCTACTGCGCCTCCATCAAGGAGCTGAGCGTCAGCGACTGCCGCTTCGTCAGCGACTTCGGCCTGCGGGAGATCGCCAAGCTGGAGTCCCGCCTGCGGTACCTGAGCATCGCGCACTGCGGCCGGGTCACCGACGTGGGCATCCGCTACGTGGCCAAGTACTGCAGCAAGCTGCGCTACCTCAACGCGAGGGGCTGCGAGGGCATCACGGACCACGGTGTGGAGTACCT

Numéro d'accès Ensembl | humain

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hui-Wen Chiu et al.
Journal of clinical medicine, 7(10) (2018-10-12)
Paclitaxel (PTX) is a common regimen used to treat patients with ovarian cancer. Although approximately 60% of ovarian cancer patients exhibit a pathologic complete response (pCR), approximately 40% of patients appear to be insensitive to PTX adjuvant therapy. Thus, identifying
Loredana Moro et al.
Nature cell biology, 22(9), 1130-1142 (2020-08-26)
Epigenetic plasticity is a pivotal factor that drives metastasis. Here, we show that the promoter of the gene that encodes the ubiquitin ligase subunit FBXL7 is hypermethylated in advanced prostate and pancreatic cancers, correlating with decreased FBXL7 mRNA and protein

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique