Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU036851

Sigma-Aldrich

MISSION® esiRNA

targeting human NTS

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGCTCCTGGAGTCTGTGCTCAGATTCAGAAGAGGAAATGAAAGCATTAGAAGCAGATTTCTTGACCAATATGCATACATCAAAGATTAGTAAAGCACATGTTCCCTCTTGGAAGATGACTCTGCTAAATGTTTGCAGTCTTGTAAATAATTTGAACAGCCCAGCTGAGGAAACAGGAGAAGTTCATGAAGAGGAGCTTGTTGCAAGAAGGAAACTTCCTACTGCTTTAGATGGCTTTAGCTTGGAAGCAATGTTGACAATATACCAGCTCCACAAAATCTGTCACAGCAGGGCTTTTCAACACTGGGAGTTAATCCAGGAAGATATTCTTGATACTGGAAATGACAAAAATGGAAAGGAAGAAGTCATAAAGAGAAAAATTCCTTATATTCTGAAACGGCAGCTGTATGA

Numéro d'accès Ensembl | humain

ENSG00000133636

Numéro d'accès NCBI

NM_006183

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... NTS(4922) , NTS(4922)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Lei Zhang et al.
Molecular therapy. Nucleic acids, 14, 262-273 (2019-01-18)
Development of the receptive endometrium (RE) from the pre-receptive endometrium (PE) is essential for embryo implantation, but its molecular mechanisms have not been fully understood. In this study, lncRNA-miRNA-mRNA and circRNA-miRNA-mRNA networks were constructed to explore the functions of potential competing endogenous
Brett Verstak et al.
Journal of leukocyte biology, 96(3), 427-436 (2014-05-09)
TLRs act as sentinels in professional immune cells to detect and initiate the innate immune response to pathogen challenge. TLR4 is a widely expressed TLR, responsible for initiating potent immune responses to LPS. TRAM acts to bridge TLR4 with TRIF
Xiao-Yu Shi et al.
Asian Pacific journal of tropical medicine, 7(10), 787-791 (2014-08-19)
To explore the effect of Fibulin-5 expression on cell proliferation and invasion in human gastric cancer patients. Fibulin-5 expression was detected in 56 samples of surgically resected gastric cancer and paired noncancerous tissues using qRT-PCR and immunoblotting. Fibulin-5 was knocked
J K Liu et al.
Cell death and differentiation, 21(8), 1325-1339 (2014-05-17)
Glioblastoma is the most common primary intrinsic brain tumor and remains incurable despite maximal therapy. Glioblastomas display cellular hierarchies with self-renewing glioma-initiating cells (GICs) at the apex. To discover new GIC targets, we used in vivo delivery of phage display
Yuqi Huang et al.
International journal of molecular sciences, 15(10), 18148-18161 (2014-10-11)
Targeting protein for Xenopus kinesin-like protein 2 (TPX2), a microtubule-associated protein, impacts spindle assembly in human cells. Several studies have demonstrated that TPX2 is overexpressed in different types of human cancers and promotes tumor growth and metastasis. In this study
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique