Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU033081

Sigma-Aldrich

MISSION® esiRNA

targeting human ACE2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAGCAAACGGTTGAACACAATTCTAAATACAATGAGCACCATCTACAGTACTGGAAAAGTTTGTAACCCAGATAATCCACAAGAATGCTTATTACTTGAACCAGGTTTGAATGAAATAATGGCAAACAGTTTAGACTACAATGAGAGGCTCTGGGCTTGGGAAAGCTGGAGATCTGAGGTCGGCAAGCAGCTGAGGCCATTATATGAAGAGTATGTGGTCTTGAAAAATGAGATGGCAAGAGCAAATCATTATGAGGACTATGGGGATTATTGGAGAGGAGACTATGAAGTAAATGGGGTAGATGGCTATGACTACAGCCGCGGCCAGTTGATTGAAGATGTGGAACATACCTTTGAAGAGATTAAACCATTATATGAACATCTTCATGCCTATGTGAGGGCAAAGTTGATGA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Miki Yamaguchi et al.
Biochemical and biophysical research communications, 487(3), 613-618 (2017-04-24)
EGFR-mutant lung adenocarcinomas contain a subpopulation of cells that have undergone epithelial-to-mesenchymal transition and can grow independently of EGFR. To kill these cancer cells, we need a novel therapeutic approach other than EGFR inhibitors. If a molecule is specifically expressed
Yingchuan Li et al.
Scientific reports, 5, 8209-8209 (2015-02-04)
ACE2 and Ang-(1-7) have important roles in preventing acute lung injury. However, it is not clear whether upregulation of the ACE2/Ang-(1-7)/Mas axis prevents LPS-induced injury in pulmonary microvascular endothelial cells (PMVECs) by inhibiting the MAPKs/NF-κB pathways. Primary cultured rat PMVECs
Xi Cao et al.
Diabetes/metabolism research and reviews, 35(4), e3123-e3123 (2019-01-04)
Previous works indicated that the stress on the endoplasmic reticulum (ER) affected nonalcoholic fatty liver disease (NAFLD). However, there is no clear evident on the effect of the regulation of ER stress by angiotensin-converting enzyme 2 (ACE2) on the prevention

Protocoles

Coronavirus qPCR Primer and probe sets for the detection of SARS-CoV-2 (Corona Virus), with additional real-time RT-PCR, RT-qPCR and supporting reagents available.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique