Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU031761

Sigma-Aldrich

MISSION® esiRNA

targeting human TRPC3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTGGGTCTGCTTGTGTTCAATGCCTCAGACAGGTTCGAAGGCATCACCACGCTGCCCAATATCACAGTTACTGACTATCCCAAACAGATCTTCAGGGTGAAAACCACCCAGTTTACATGGACTGAAATGCTAATTATGGTCTGGGTTCTTGGAATGATGTGGTCTGAATGTAAAGAGCTCTGGCTGGAAGGACCTAGGGAATACATTTTGCAGTTGTGGAATGTGCTTGACTTTGGGATGCTGTCCATCTTCATTGCTGCTTTCACAGCCAGATTCCTAGCTTTCCTTCAGGCAACGAAGGCACAACAGTATGTGGACAGTTACGTCCAAGAGAGTGACCTCAGTGAAGTGACACTCCCACCAGAGATACAGTATTTCACTTATGCTAGAGATAAATGGCTCCCTTCTGACCCTCAGATTATATCTGAAGGCCTTTATGCCATAGCTGTTGTGCTCAGCTTCTCTCGGATTGCGTAC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Lingwei Wang et al.
Biochemical and biophysical research communications, 484(1), 209-217 (2016-12-31)
Airway hyperresponsiveness (AHR), airway remodeling and inflammation are the fundamental pathological alterations that occur in asthma. Transient receptor potential canonical 3 (TRPC3) has been implicated in diverse functions of airway smooth muscle cells (ASMCs) in asthma. However, the underlying mechanisms
Xiaoyu Zhang et al.
Journal of cellular biochemistry, 119(7), 6033-6044 (2018-03-27)
This study aimed to validate whether transient receptor potential channel1 (TRPC1) and TRPC3 participate in the regulation the proliferation of airway smooth muscle cells (ASMCs) through modulating calcium ion (Ca2+ ) influx in vitro. Chronic model of murine asthma was
Xiao-Xu Chen et al.
Life sciences, 187, 64-73 (2017-08-15)
Canonical transient receptor potential channel-3 (TRPC3)-encoded Ca Primary mouse ASMCs were cultured with or without ACh treatment, then cell viability, TRPC3 expression, NSCC currents and [Ca TRPC3 blocker Gd Our data suggested ACh could induce ASMC proliferation, and TRPC3 may
Pengzhou Hang et al.
International journal of biological sciences, 11(5), 536-545 (2015-04-22)
Brain-derived neurotrophic factor (BDNF) is associated with coronary artery diseases. However, its role and mechanism in myocardial infarction (MI) is not fully understood. Wistar rat and Kunming mouse model of MI were induced by the ligation of left coronary artery.
Kexin Meng et al.
PloS one, 9(6), e98777-e98777 (2014-06-07)
Calcium-sensing receptor (CaSR) has been demonstrated to be present in several tissues and cells unrelated to systemic calcium homeostasis, where it regulates a series of diverse cellular functions. A previous study indicated that CaSR is expressed in mouse glomerular mesangial

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique