Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU030961

Sigma-Aldrich

MISSION® esiRNA

targeting human ERBB3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGGAACTGTGCACAAAGGAGTGTGGATCCCTGAGGGTGAATCAATCAAGATTCCAGTCTGCATTAAAGTCATTGAGGACAAGAGTGGACGGCAGAGTTTTCAAGCTGTGACAGATCATATGCTGGCCATTGGCAGCCTGGACCATGCCCACATTGTAAGGCTGCTGGGACTATGCCCAGGGTCATCTCTGCAGCTTGTCACTCAATATTTGCCTCTGGGTTCTCTGCTGGATCATGTGAGACAACACCGGGGGGCACTGGGGCCACAGCTGCTGCTCAACTGGGGAGTACAAATTGCCAAGGGAATGTACTACCTTGAGGAACATGGTATGGTGCATAGAAACCTGGCTGCCCGAAACGTGCTACTCAAGTCACCCAGTCAGGTTCAGGTGGCAGATTTTGGTGTGGCTGACCT

Numéro d'accès Ensembl | humain

ENSG00000065361

Numéro d'accès NCBI

NM_001982

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ERBB3(2065) , ERBB3(2065)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Sarah Croessmann et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 25(1), 277-289 (2018-10-14)
We examined the role of ERBB2-activating mutations in endocrine therapy resistance in estrogen receptor positive (ER+) breast cancer. ERBB2 mutation frequency was determined from large genomic databases. Isogenic knock-in ERBB2 mutations in ER+ MCF7 cells and xenografts were used to
Majid Momeny et al.
Cellular oncology (Dordrecht), 42(4), 491-504 (2019-04-27)
Pancreatic ductal adenocarcinoma (PDAC), the most common malignancy of the pancreas, is the fourth most common cause of cancer-related death in the USA. Local progression, early tumor dissemination and low efficacy of current treatments are the major reasons for its
Human Papillomavirus Regulates HER3 Expression in Head and Neck Cancer: Implications for Targeted HER3 Therapy in HPV
Toni M Brand et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 23(12), 3072-3083 (2016-12-18)
Aili Wang et al.
Aging, 12(6), 4866-4878 (2020-03-15)
Development of specific serum biomarkers is essential to improve diagnosis and prognosis of non-small cell lung cancer (NSCLC). Here, we show that serum and tissue levels of miR-519d are significantly decreased in NSCLC patients. The low expression of miR-519d is
Spencer S Watson et al.
Cell systems, 6(3), 329-342 (2018-03-20)
Extrinsic signals are implicated in breast cancer resistance to HER2-targeted tyrosine kinase inhibitors (TKIs). To examine how microenvironmental signals influence resistance, we monitored TKI-treated breast cancer cell lines grown on microenvironment microarrays composed of printed extracellular matrix proteins supplemented with
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique