Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU028931

Sigma-Aldrich

MISSION® esiRNA

targeting human CTSG

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATAATCAGCGGACCATCCAGAATGACATCATGTTATTGCAGCTGAGCAGAAGAGTCAGACGGAATCGAAACGTGAACCCAGTGGCTCTGCCTAGAGCCCAGGAGGGACTGAGACCCGGGACGCTGTGCACTGTGGCCGGCTGGGGCAGGGTCAGCATGAGGAGGGGAACAGATACACTCCGAGAGGTGCAGCTGAGAGTGCAGAGGGATAGGCAGTGCCTCCGCATCTTCGGTTCCTACGACCCCCGAAGGCAGATTTGTGTGGGGGACCGGCGGGAACGGAAGGCTGCCTTCAAGGGGGATTCCGGAGGCCCCCTGCTGTGTAACAATGTGGCCCACGGCATCGTCTCCTATGGAAAGTCGTCAGGGGTTCCTCCAGAAGTCTTCACCAGGGTCTCAAGTTTCCTGCCCTGGATA

Numéro d'accès Ensembl | humain

ENSG00000100448

Numéro d'accès NCBI

NM_001911

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CTSG(1511) , CTSG(1511)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Kyung Ho Han et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 30(2), 738-747 (2015-10-21)
We have devised a method of using intracellular combinatorial libraries to select antibodies that control cell fates. Many agonist antibodies have been selected with this method, and the process appears to be limited only by the availability of a phenotypic
Seon Min Woo et al.
Oncotarget, 8(63), 106672-106684 (2018-01-02)
Cathepsin G is a serine protease secreted from activated neutrophils, it has important roles in inflammation and immune response. Moreover, cathepsin G promotes tumor cell-cell adhesion and migration in cancer cells. In this study, we investigated whether inhibition of cathepsin
S K Sengodan et al.
Oncogenesis, 6(9), e376-e376 (2017-09-05)
Human chorionic gonadotropin β (β-hCG) has been implicated in breast tumorigenesis. However, the role of this hormone is highly controversial as certain studies suggest it has anti-tumor properties while others have found it to be pro-tumorigenic. To unveil the truth
Sudha Saryu Malhotra et al.
Scientific reports, 5, 11210-11210 (2015-06-09)
The aim of the present study is to delineate the role of human chorionic gonadotropin (hCG) in trophoblast fusion. In this direction, using shRNA lentiviral particles, α- and β-hCG silenced 'BeWo' cell lines were generated. Treatment of both α- and

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique