Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU025291

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC9A3R1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCTTCACCAATGGGGAGATACAGAAGGAGAACAGTCGTGAAGCCCTGGCAGAGGCAGCCTTGGAGAGCCCCAGGCCAGCCCTGGTGAGATCCGCCTCCAGTGACACCAGCGAGGAGCTGAATTCCCAAGACAGCCCCCCAAAACAGGACTCCACAGCGCCCTCGTCTACCTCCTCCTCCGACCCCATCCTAGACTTCAACATCTCCCTGGCCATGGCCAAAGAGAGGGCCCACCAGAAACGCAGCAGCAAACGGGCCCCGCAGATGGACTGGAGCAAGAAAAACGAACTCTTCAGCAACCTCTGAGCGCCCTGCTGCCACCCAGTGACTGGCAGGGCCGAGCCAGCATTCCACCCCACCTTTTTCCTTCTCCCCAATTACTCCCCTGAATCAATGTACAAATCAGCACCCACATCCCCTTTCTTGACAAATGATTTTTCTAGAGAACTATGTTCTTCCCTGACTTTAGGGAAGGTGAATGTGTTCCCGT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Darren K Patten et al.
Nature medicine, 24(9), 1469-1480 (2018-07-25)
The degree of intrinsic and interpatient phenotypic heterogeneity and its role in tumor evolution is poorly understood. Phenotypic drifts can be transmitted via inheritable transcriptional programs. Cell-type specific transcription is maintained through the activation of epigenetically defined regulatory regions including
Rosa Rubino et al.
Pflugers Archiv : European journal of physiology, 466(12), 2269-2278 (2014-03-07)
Pseudomonas aeruginosa infections of the airway cells decrease apical expression of both wild-type (wt) and F508del CFTR through the inhibition of apical endocytic recycling. CFTR endocytic recycling is known to be regulated by its interaction with PDZ domain containing proteins.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique