Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU024131

Sigma-Aldrich

MISSION® esiRNA

targeting human KCNN1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTCAGCATCTCCTCCTGGATCATCGCAGCCTGGACCGTGCGCGTCTGCGAGAGGTACCACGACAAGCAGGAAGTGACCAGCAACTTCCTGGGGGCCATGTGGCTGATTTCCATCACCTTCCTCTCCATTGGCTACGGCGACATGGTGCCCCACACCTACTGCGGGAAGGGTGTGTGCCTGCTCACTGGCATCATGGGAGCTGGCTGTACCGCGCTCGTGGTGGCTGTGGTGGCTCGGAAGCTGGAGCTCACCAAGGCTGAGAAGCACGTGCACAACTTCATGATGGACACTCAGCTCACCAAGCGGGTAAAAAACGCCGCTGCTAACGTTCTCAGGGAGACGTGGCTCATCTACAAACATACCAGGCTGGTGAAGAAGCCAGACCAAGCCCGGGTTCGGAAACACCAGCGTAAGTTCCTCCAAGCCATCCATCATGGCAGGATGCTCCGGAGTGTGAAGATCGAGCAAGGGAAGCTGAACGACCAGGCTAA

Numéro d'accès Ensembl | humain

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Désolés, nous n'avons pas de COA pour ce produit disponible en ligne pour le moment.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Young-Jin Seo et al.
PloS one, 8(8), e75005-e75005 (2013-10-19)
Influenza continues to pose a threat to humans by causing significant morbidity and mortality. Thus, it is imperative to investigate mechanisms by which influenza virus manipulates the function of host factors and cellular signal pathways. In this study, we demonstrate
Heba Alshaker et al.
Frontiers in pharmacology, 10, 303-303 (2019-04-12)
Sphingosine kinases 1 and 2 (SK1 and SK2) are proto-oncogenic isozymes expressed in many human tumors and associated with chemoresistance and poor prognosis. They are well-recognized therapy targets and their inhibition was shown to induce tumor volume reduction and chemosensitization
Ilari Pulli et al.
Biochimica et biophysica acta, 1853(9), 2173-2182 (2015-04-22)
Caveolae are plasma membrane invaginations enriched in sterols and sphingolipids. Sphingosine kinase 1 (SK1) is an oncogenic protein that converts sphingosine to sphingosine 1-phosphate (S1P), which is a messenger molecule involved in calcium signaling. Caveolae contain calcium responsive proteins, but

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique