Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU024041

Sigma-Aldrich

MISSION® esiRNA

targeting human GATA1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCAGCTTCCTGGAGACTTTGAAGACAGAGCGGCTGAGCCCAGACCTCCTGACCCTGGGACCTGCACTGCCTTCATCACTCCCTGTCCCCAATAGTGCTTATGGGGGCCCTGACTTTTCCAGTACCTTCTTTTCTCCCACCGGGAGCCCCCTCAATTCAGCAGCCTATTCCTCTCCCAAGCTTCGTGGAACTCTCCCCCTGCCTCCCTGTGAGGCCAGGGAGTGTGTGAACTGCGGAGCAACAGCCACTCCACTGTGGCGGAGGGACAGGACAGGCCACTACCTATGCAACGCCTGCGGCCTCTATCACAAGATGAATGGGCAGAACAGGCCCCTCATCCGGCCCAAGAAGCGCCTGATTGTCAGTAAACGGGCAGGTACTCAGTGCACCAACTGCCAGACGACCACCACGACACTGTGGCGGAGAAATGCCAGTGGGGATCCCGTGTGCAATGCCTGCGGCCTCTACTACAAGCTACACCAGGTGAACCG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Désolés, nous n'avons pas de COA pour ce produit disponible en ligne pour le moment.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Miranda L Xu et al.
Journal of neurochemistry, 146(4), 390-402 (2018-04-21)
Acetylcholinesterase (AChE; EC 3.1.1.7) is known to hydrolyze acetylcholine at cholinergic synapses. In mammalian erythrocyte, AChE exists as a dimer (G2 ) and is proposed to play role in erythropoiesis. To reveal the regulation of AChE during differentiation of erythroblast
Anouck Wijgaerts et al.
Haematologica, 102(4), 695-706 (2017-01-14)
Gray platelet syndrome is named after the gray appearance of platelets due to the absence of α-granules. It is caused by recessive mutations in
Pavel Burda et al.
PloS one, 11(3), e0152234-e0152234 (2016-03-25)
GATA-1 and PU.1 are two important hematopoietic transcription factors that mutually inhibit each other in progenitor cells to guide entrance into the erythroid or myeloid lineage, respectively. PU.1 controls its own expression during myelopoiesis by binding to the distal URE
A Maroz et al.
Leukemia, 28(6), 1259-1270 (2013-12-18)
Transient leukemia (TL) is evident in 5-10% of all neonates with Down syndrome (DS) and associated with N-terminal truncating GATA1 mutations (GATA1s). Here we report that TL-cell clones generate abundant eosinophils in a substantial fraction of patients. Sorted eosinophils from
John Timothy Caldwell et al.
PloS one, 8(7), e68601-e68601 (2013-07-23)
It has been previously shown that acute myeloid leukemia (AML) patients with higher levels of GATA1 expression have poorer outcomes. Furthermore, pediatric Down syndrome (DS) patients with acute megakaryocytic leukemia (AMKL), whose blast cells almost universally harbor somatic mutations in

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique