Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU021751

Sigma-Aldrich

MISSION® esiRNA

targeting human ALKBH5

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTCAAGCCTATTCGGGTGTCGGAACCAGTGCTTTCCCTGCCGGTGCGCAGGGGAAGCGTGACTGTGCTCAGTGGATATGCTGCTGATGAAATCACTCACTGCATACGGCCTCAGGACATCAAGGAGCGCCGAGCAGTCATCATCCTCAGGAAGACAAGATTAGATGCACCCCGGTTGGAAACAAAGTCCCTGAGCAGCTCCGTGTTACCACCCAGCTATGCTTCAGATCGCCTGTCAGGAAACAACAGGGACCCTGCTCTGAAACCCAAGCGGTCCCACCGCAAGGCAGACCCTGATGCTGCCCACAGGCCACGGATCCTGGAGATGGACAAGGAAGAGAACCGGCGCTCGGTGCTGCTGCCCACACACCGGCGGAGGGGTAGCTTCAGCTCTGAGAACTACTGGCGCAAGTCATACGAGTCCTCAGAGGACTGCTCTGAGGCAGCAGGCAGCCCTGCCCGAAAGTCTACCCGCCGCCCTCCTGGGAACTCTGGCTC

Numéro d'accès Ensembl | humain

ENSG00000091542

Numéro d'accès NCBI

NM_017758

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ALKBH5(54890) , ALKBH5(54890)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Zhiyuan Zhu et al.
Gene, 731, 144348-144348 (2020-01-14)
Mounting evidence demonstrates that N6-methyladenosine (m6A) play critical roles of m6A in the epigenetic regulation, especially for human cancer. The m6A modification is installed by methyltransferase and erased demethylases, leading to the significant modification for gene expression and cell fate.
Lianpin Wu et al.
BMC cancer, 19(1), 326-326 (2019-04-07)
Breast cancer (BC) displays striking genetic, epigenetic and phenotypic diversity. N6-methyladenosine (m6A) in mRNA has emerged as a crucial epitranscriptomic modification that controls cancer self-renewal and cell fate. However, the key enzymes of m6A expression and function in human breast
Chenyue Ding et al.
Journal of cellular physiology, 233(9), 7055-7066 (2018-02-01)
The N6-methyladenosine (m6A) modification plays a central role in epigenetic regulation of the mammalian transcriptome. m6A can be demethylated by the fat mass- and obesity-associated (FTO) protein and the α-ketoglutarate-dependent dioxygenase alkB homolog 5 (ALKBH5) protein. Much less is known
Omprakash Shriwas et al.
Apoptosis : an international journal on programmed cell death, 25(3-4), 233-246 (2020-01-25)
Platinum based drugs alone or in combination with 5FU and docetaxel are common regimen chemotherapeutics for the treatment of advanced OSCC. Chemoresistance is one of the major factors of treatment failure in OSCC. Human RNA helicase DDX3 plays an important
Rong Wu et al.
Cell research, 29(1), 23-41 (2018-12-06)
While N6-methyladenosine (m6A), the most abundant internal modification in eukaryotic mRNA, is linked to cell differentiation and tissue development, the biological significance of m6A modification in mammalian glial development remains unknown. Here, we identify a novel m6A reader, Prrc2a (Proline
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique