Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

Voir toute la documentation

EHU021061

Sigma-Aldrich

MISSION® esiRNA

targeting human SOX9

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATCAAGACGGAGCAGCTGAGCCCCAGCCACTACAGCGAGCAGCAGCAGCACTCGCCCCAACAGATCGCCTACAGCCCCTTCAACCTCCCACACTACAGCCCCTCCTACCCGCCCATCACCCGCTCACAGTACGACTACACCGACCACCAGAACTCCAGCTCCTACTACAGCCACGCGGCAGGCCAGGGCACCGGCCTCTACTCCACCTTCACCTACATGAACCCCGCTCAGCGCCCCATGTACACCCCCATCGCCGACACCTCTGGGGTCCCTTCCATCCCGCAGACCCACAGCCCCCAGCACTGGGAACAACCCGTCTACACACAGCTCACTCGACCTTGAGGAGGCCTCCCACGAAGGGCGAAGATGGCCGAGATGATCCTAAAAATAACCGAAGAAAGAGAGGACCAACCAGAATTCCCT

Numéro d'accès Ensembl | humain

ENSG00000125398

Numéro d'accès NCBI

NM_000346

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SOX9(6662) , SOX9(6662)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Haiyun Luo et al.
Journal of endodontics, 44(5), 792-799 (2018-03-25)
The process of pulpitis is characterized by extracellular matrix imbalance and inflammatory cell infiltration. As an essential transcription factor, sex-determining region Y-box 9 (SOX9) is significantly inhibited by tumor necrosis factor alpha in inflammatory joint diseases. The aim of this
Jing Wang et al.
Oncotarget, 8(1), 574-582 (2016-11-24)
Cisplatin-based chemotherapy is the most commonly used treatment regimen for gastric cancer (GC), however, the resistance to cisplatin represents the key limitation for the therapeutic efficacy. Aberrant expression of MiR-524-5p appears to be involves in tumorigenesis and chemoresistance. However, the
Xiuyu Wang et al.
Biochemical and biophysical research communications, 516(1), 236-244 (2019-06-22)
The malignant proliferation is one of the major characteristic for tumor cells, however the mechanism of lung cancer cells uncontrollable proliferation is still confusing. This study investigated the mechanism of up-regulated FOXA1 in lung cancer and its tumorigenic function in
C-Q Liu et al.
European review for medical and pharmacological sciences, 23(13), 5628-5639 (2019-07-13)
The aim of the current study was to investigate the potential roles of miR-215-3p in the progression of cervical cancer. The levels of miR-215-3p in both cervical cancer tissues and cell lines were detected using quantitative Real-time polymerase chain reaction
J-C Shang et al.
European review for medical and pharmacological sciences, 23(14), 6160-6169 (2019-08-01)
Gastric cancer is one of the most common gastrointestinal malignancy, which is often diagnosed at an advanced stage. MicroRNA-105 (miR-105) was downregulated and acts as a tumor suppressor in various cancers. The purpose of this study was to explore the
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique