Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU020611

Sigma-Aldrich

MISSION® esiRNA

targeting human MUS81

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGTCGGTGCGAGAAGTGTTTGCCCGGCAGCTGATGCAGGTGCGCGGAGTGAGTGGGGAGAAGGCAGCAGCCCTGGTGGATCGATACAGCACCCCTGCCAGCCTCCTGGCCGCCTATGATGCCTGTGCCACCCCCAAGGAACAAGAGACACTGCTGAGCACCATTAAGTGTGGGCGTCTACAGAGGAATCTGGGGCCTGCTCTGAGCAGGACCTTATCCCAGCTCTACTGCAGCTACGGCCCCTTGACCTGAGCTTATGCCGTGAAACAGCCCCCAGCCCCCGTCTGTCCCCCAACCCAGGCTAGCCAGCCTTTTAACAACATCTTTTGGGGTACAATTAGAATCTAAGTGTTTGCAGCCATATGTGTCATGTAGAAGATGCCTAGCCCTGGGGACCTTGTGAAATACGCAGGAACCAGGGATAC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ying Wai Chan et al.
Nature communications, 5, 4844-4844 (2014-09-12)
Holliday junction (HJ) resolvases are necessary for the processing of persistent recombination intermediates before cell division. Their actions, however, need to be restricted to the late stages of the cell cycle to avoid the inappropriate cleavage of replication intermediates. Control
Delphine Lemaçon et al.
Nature communications, 8(1), 860-860 (2017-10-19)
The breast cancer susceptibility proteins BRCA1 and BRCA2 have emerged as key stabilizing factors for the maintenance of replication fork integrity following replication stress. In their absence, stalled replication forks are extensively degraded by the MRE11 nuclease, leading to chemotherapeutic
Yuping Yin et al.
Molecular cancer therapeutics, 18(8), 1439-1450 (2019-05-31)
DNA replication and repair proteins play an important role in cancer initiation and progression by affecting genomic instability. The DNA endonuclease Mus81 is a DNA structure-specific endonuclease, which has been implicated in DNA replication and repair. In this study, we
Ying Wai Chan et al.
Nature cell biology, 20(1), 92-103 (2017-12-20)
The resolution of joint molecules that link recombining sister chromatids is essential for chromosome segregation. Here, we determine the fate of unresolved recombination intermediates arising in cells lacking two nucleases required for resolution (GEN1 -/- knockout cells depleted of MUS81).
Haiqing Fu et al.
Nature communications, 6, 6746-6746 (2015-04-17)
The Mus81 endonuclease resolves recombination intermediates and mediates cellular responses to exogenous replicative stress. Here, we show that Mus81 also regulates the rate of DNA replication during normal growth by promoting replication fork progression while reducing the frequency of replication

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique