Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU016621

Sigma-Aldrich

MISSION® esiRNA

targeting human CEBPG

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GATATCGCAGCAAAACAGCACTCCAGGGGTGAACGGAATTAGTGTTATCCATACCCAGGCACATGCCAGCGGCTTACAGCAGGTTCCTCAGCTGGTGCCTGCTGGCCCTGGGGGAGGAGGCAAAGCTGTGGCTCCCAGCAAGCAGAGCAAAAAGAGTTCGCCCATGGATCGAAACAGTGACGAGTATCGGCAACGCCGAGAGAGGAACAACATGGCTGTGAAAAAGAGCCGGTTGAAAAGCAAGCAGAAAGCACAAGACACACTGCAGAGAGTCAATCAGCTCAAAGAAGAGAATGAACGGTTGGAAGCAAAAATCAAATTGCTGACCAAGGAATTAAGTGTACTCAAAGATTTGTTTCTTGAGCATGCACACAACCTTGCAGACAACGTACAGTCCATTAGCACTGAAAATACGACAGCAGATGGCGACAATGCAGGACAGTAGACCTCACCCTTTCCAGACTTTAGAGCTTGTGGCTTGAATGTTAAAGGTGTGACCACCGACA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yanhui Yu et al.
DNA and cell biology, 36(3), 212-218 (2017-01-17)
Autophagy is a main defense strategy by which infected host cells can virtually induce the killing of parasite, including Toxoplasma gondii. However, the regulatory mechanisms of autophagy in T. gondii-infected nonhematopoietic cells are still unknown. Emerging evidence indicates that CCAAT/enhancer-binding
Hyun Lim et al.
Phytomedicine : international journal of phytotherapy and phytopharmacology, 76, 153255-153255 (2020-06-20)
Prolonged exposure to the senescence-associated secretory phenotype (SASP) with age leads to chronic low-grade inflammation in neighboring cells and tissues, causing many chronic degenerative diseases. The effects on SASP production of the ethanol extract from Scutellaria radix and 17 isolated
Nirmalya Dasgupta et al.
Biochimica et biophysica acta, 1861(7), 1777-1787 (2017-03-28)
Human polo-like kinase 1 (PLK1), a highly conserved serine/threonine kinase is a key player in several essential cell-cycle events. PLK1 is considered an oncogene and its overexpression often correlates with poor prognosis of cancers, including colorectal cancer (CRC). However, regulation
Hye-Lim Lee et al.
International journal of molecular sciences, 19(10) (2018-10-17)
Distal-less homeobox 5 (Dlx5) is a negative regulator of adipogenesis. Dlx5 expression is decreased by adipogenic stimuli, but the mechanisms of Dlx5 downregulation by adipogenic stimuli have not yet been determined. Here, we tested the impact of cAMP/PKA (protein kinase
Hong Li et al.
Genetic testing and molecular biomarkers, 23(5), 304-309 (2019-04-11)
Aims: Metastasis is a significant obstacle to curing esophageal squamous cell carcinoma (ESCC). The CCAAT/enhancer binding protein β (C/EBPβ)

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique