Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU016451

Sigma-Aldrich

MISSION® esiRNA

targeting human PTPN1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TATCCGACATGAAGCCAGTGACTTCCCATGTAGAGTGGCCAAGCTTCCTAAGAACAAAAACCGAAATAGGTACAGAGACGTCAGTCCCTTTGACCATAGTCGGATTAAACTACATCAAGAAGATAATGACTATATCAACGCTAGTTTGATAAAAATGGAAGAAGCCCAAAGGAGTTACATTCTTACCCAGGGCCCTTTGCCTAACACATGCGGTCACTTTTGGGAGATGGTGTGGGAGCAGAAAAGCAGGGGTGTCGTCATGCTCAACAGAGTGATGGAGAAAGGTTCGTTAAAATGCGCACAATACTGGCCACAAAAAGAAGAAAAAGAGATGATCTTTGAAGACACAAATTTGAAATTAACATTGATCTCTGAAGATATCAAGTCATATTATACAGTGCGACAGCTAGAATTGGAAAACCTTACAACCCAAGAAACTCGAGAGATCTTACATTTCCACTATACCACATGGCCTGACTTTGGAGTCCCTGAATCACCAGCCTCATT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Akarawin Hongdusit et al.
Nature communications, 11(1), 788-788 (2020-02-09)
Protein tyrosine phosphatases regulate a myriad of essential subcellular signaling events, yet they remain difficult to study in their native biophysical context. Here we develop a minimally disruptive optical approach to control protein tyrosine phosphatase 1B (PTP1B)-an important regulator of
Caroline E Nunes-Xavier et al.
Diagnostic pathology, 14(1), 134-134 (2019-12-16)
Protein tyrosine phosphatases (PTPs) regulate neuronal differentiation and survival, but their expression patterns and functions in human neuroblastoma (NB) are scarcely known. Here, we have investigated the function and expression of the non-receptor PTPN1 on human NB cell lines and
Liza D Morales et al.
PloS one, 9(5), e97104-e97104 (2014-05-09)
To maintain tissue homeostasis, apoptosis is functionally linked to the cell cycle through the retinoblastoma (Rb)/E2F pathway. When the Rb tumor suppressor protein is functionally inactivated, E2F1 elicits an apoptotic response through both intrinsic (caspase-9 mediated) and extrinsic (caspase-8 mediated)
Samuel Legeay et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 127, 110200-110200 (2020-05-18)
Diabetes notably increases the risk for endothelial dysfunction, a main precursor for microvascular complications. While endoplasmic reticulum stress (ERS) and protein tyrosine phosphatase 1B (PTP1B) have been associated with endothelial dysfunction in resistance vessels, whether these mechanisms also contribute to
Xiaoyan Zhang et al.
Scientific reports, 5, 12987-12987 (2015-08-12)
Renal mesangial cells (RMCs) constitute a population of cells in glomerular mesangium. Inflammatory cytokines produced by RMCs play a vital role in renal inflammation. miRNAs are key regulators of inflammatory cytokine expression. The abnormal expression of renal miRNAs and the

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique