Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU011991

Sigma-Aldrich

MISSION® esiRNA

targeting human FER

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GACACCTCATCATGGACACGCTACTTTAGCTAAGGCATGACCAGCAATGAACAGTAGTAAGATATGTGCTGATTAGAAGGCTCACTTGTGCAGTGTGGAGGATAACCAGTGCCTTACAAAATGGGGTTTGGGAGTGACCTGAAGAATTCACATGAAGCAGTGTTAAAATTGCAAGACTGGGAATTACGGTTACTGGAAACAGTAAAGAAATTTATGGCCCTGAGAATAAAAAGTGATAAAGAATATGCATCTACTTTACAGAACCTTTGTAATCAAGTTGATAAGGAAAGTACTGTCCAAATGAATTATGTCAGCAACGTATCCAAGTCTTGGCTACTTATGATTCAGCAGACAGAACAACTTAGTAGGATAATGAAGACACATGCAGAGGACTTGAACTCTGGACCTTTACACAGGCTCACCATGATGA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ana Lonic et al.
The Journal of cell biology, 220(2) (2021-01-08)
Receptor degradation terminates signaling by activated receptor tyrosine kinases. Degradation of EGFR occurs in lysosomes and requires the switching of RAB5 for RAB7 on late endosomes to enable their fusion with the lysosome, but what controls this critical switching is
Yoav Elkis et al.
Nature communications, 8(1), 940-940 (2017-10-19)
Disruption of the reprogrammed energy management system of malignant cells is a prioritized goal of targeted cancer therapy. Two regulators of this system are the Fer kinase, and its cancer cell specific variant, FerT, both residing in subcellular compartments including
Joanna Stanicka et al.
Oncogene, 37(23), 3131-3150 (2018-03-16)
IGF-1 receptor (IGF-1R) and integrin cooperative signaling promotes cancer cell survival, proliferation, and motility, but whether this influences cancer progression and therapy responses is largely unknown. Here we investigated the non-receptor tyrosine adhesion kinase FES-related (FER), following its identification as

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique