Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU010651

Sigma-Aldrich

MISSION® esiRNA

targeting human MMP12

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTTCTTCCTTATGGCCAACCTTGCCATCTGGCATTGAAGCTGCTTATGAAATTGAAGCCAGAAATCAAGTTTTTCTTTTTAAAGATGACAAATACTGGTTAATTAGCAATTTAAGACCAGAGCCAAATTATCCCAAGAGCATACATTCTTTTGGTTTTCCTAACTTTGTGAAAAAAATTGATGCAGCTGTTTTTAACCCACGTTTTTATAGGACCTACTTCTTTGTAGATAACCAGTATTGGAGGTATGATGAAAGGAGACAGATGATGGACCCTGGTTATCCCAAACTGATTACCAAGAACTTCCAAGGAATCGGGCCTAAAATTGATGCAGTCTTCTACTCTAAAAACAAATACTACTATTTCTTCCAAGGATCTAACCAATTTGAATATGACTTCCTACTCCAACGTATCACCAAAACACTGAAAAGCA

Numéro d'accès Ensembl | humain

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Bharath Chelluboina et al.
Scientific reports, 5, 9504-9504 (2015-05-09)
This study highlights the possible pathological role of MMP-12 in the context of ischemic stroke. Male rats were subjected to a two-hour middle cerebral artery occlusion (MCAO) procedure. MMP-12 shRNA expressing plasmid formulation was administered to these rats twenty-four hours
Seung Pil Yun et al.
British journal of pharmacology, 171(13), 3283-3297 (2014-03-19)
Reactive oxygen species (ROS) are potent regulators of stem cell behaviour; however, their physiological significance as regards MMP-mediated regulation of the motility of human umbilical cord blood-derived mesenchymal stem cells (UCB-MSCs) has not been characterized. In the present study, we

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique