Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU009781

Sigma-Aldrich

MISSION® esiRNA

targeting human NRIP1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CGGAAGAGGCTGTCTGATTCTATCATGAATTTAAACGTAAAGAAGGAAGCTTTGCTAGCTGGCATGGTTGACAGTGTGCCTAAAGGCAAACAGGATAGCACATTACTGGCCTCTTTGCTTCAGTCATTCAGCTCTAGGCTGCAGACTGTTGCTCTGTCACAACAAATCAGGCAGAGCCTCAAGGAGCAAGGATATGCCCTCAGTCATGATTCTTTAAAAGTGGAGAAGGATTTAAGGTGCTATGGTGTTGCATCAAGTCACTTAAAAACTTTGTTGAAGAAAAGTAAAGTTAAAGATCAAAAGCCTGATACGAATCTTCCTGATGTGACTAAAAACCTCATCAGAGATAGGTTTGCAGAGTCTCCTCATCATGTTGGACAAAGTGGAACAAAGGTCATGAGTGAACCGTTGTCATGTGCTGCAAGATTACAGGC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hongying Piao et al.
The journal of physiological sciences : JPS, 67(1), 141-150 (2016-03-28)
Estrogen withdrawal following menopause results in an increase of osteoclasts formation and bone resorption, which is one of the most important mechanisms of postmenopausal osteoporosis. Recently, growing evidence has suggested that receptor-interacting protein 140 was implicated in estrogen-regulated metabolic disease
J You et al.
Acta physiologica (Oxford, England), 220(1), 58-71 (2016-09-11)
The transcriptional cofactor receptor-interacting protein 140 (RIP140) is known as a deleterious regulator of cardiac mitochondrial function and energy metabolic homeostasis. This study revealed that RIP140 repressed Sirtuin 3 (SIRT3), a mitochondrial deacetylase that plays an important role in regulating
X F Ni et al.
Neoplasma, 65(6), 881-887 (2018-06-27)
Nuclear receptor interacting protein (NRIP1), also known as RIP140, is a transcriptional co-regulator required for the maintenance of energy homeostasis and ovulation. Although several studies have identified roles for NRIP1 in various cell processes, the biological functions of NRIP1 in

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique