Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU007551

Sigma-Aldrich

MISSION® esiRNA

targeting human LCN2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAATTCCAGGGGAAGTGGTATGTGGTAGGCCTGGCAGGGAATGCAATTCTCAGAGAAGACAAAGACCCGCAAAAGATGTATGCCACCATCTATGAGCTGAAAGAAGACAAGAGCTACAATGTCACCTCCGTCCTGTTTAGGAAAAAGAAGTGTGACTACTGGATCAGGACTTTTGTTCCAGGTTGCCAGCCCGGCGAGTTCACGCTGGGCAACATTAAGAGTTACCCTGGATTAACGAGTTACCTCGTCCGAGTGGTGAGCACCAACTACAACCAGCATGCTATGGTGTTCTTCAAGAAAGTTTCTCAAAACAGGGAGTACTTCAAGATCACCCTCTACGGGAGAACCAAGGAGCTGACTTCGGAACTAAAGGAGAACTTCATCCGCTTCTCCAAATCTCTGGGCCTCCCTGAAAACCACATCGTCTTCCCTGTC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Se-Lim Kim et al.
Cancer science, 108(11), 2176-2186 (2017-09-01)
Lipocalin 2 (LCN2), a member of the lipocalin superfamily, plays an important role in oncogenesis and progression in various types of cancer. However, the expression pattern and functional role of LCN2 in colorectal cancer (CRC) is still poorly understood. The
Masafumi Okuda et al.
Oncotarget, 8(21), 34670-34677 (2017-04-15)
Esophageal cancer is the eighth most common cancer and the sixth most common cause of cancer-related deaths worldwide. Despite the research progress in understanding the disease, the mechanism underlying the metastasis is still unclear. Here, we successfully generated a highly
Bilge Ören et al.
The Journal of pathology, 239(3), 274-285 (2016-04-03)
Tumour cell-secreted factors skew infiltrating immune cells towards a tumour-supporting phenotype, expressing pro-tumourigenic mediators. However, the influence of lipocalin-2 (Lcn2) on the metastatic cascade in the tumour micro-environment is still not clearly defined. Here, we explored the role of stroma-derived
Peng Guo et al.
Theranostics, 6(1), 1-13 (2016-01-02)
Lipocalin 2 (Lcn2) is a promising therapeutic target as well as a potential diagnostic biomarker for breast cancer. It has been previously shown to promote breast cancer progression by inducing the epithelial to mesenchymal transition in breast cancer cells as

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique