Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU007471

Sigma-Aldrich

MISSION® esiRNA

targeting human ST6GALNAC5

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTACTCGCCACAAGATGCTGCAGTTTGATGAGCTCTTCAAGCAGGAGACTGGCAAAGACAGGAAGATATCCAACACTTGGCTCAGCACTGGCTGGTTTACAATGACAATTGCACTGGAGCTCTGTGACAGGATCAATGTTTATGGCATGGTGCCCCCAGACTTCTGCAGGGATCCCAATCACCCTTCAGTACCTTATCATTATTATGAACCTTTTGGACCTGATGAATGTACAATGTACCTCTCCCATGAGCGAGGACGCAAGGGCAGTCATCACCGCTTTATCACAGAGAAACGAGTCTTTAAGAACTGGGCACGGACATTCAATATTCACTTTTTTCAACCAGACTGGAAACCAGAATCACTTGCTATAAATCATCCTGAGAATAAACCTGTGTTCTAAGGAATGAGCATGCCAGACTGTAATCCCAGGTATTCACTGCATCAGACACCGAGACACTGAACTTCCTGAGCCACCAGACAGGAAAGGGTAGCAGAAAACAGCTTCACTCCTCAGGAAGTACCATGGACAGACGCC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Actions biochimiques/physiologiques

ST6GALNAC5 (α-N-acetylgalactosaminide α-2,6-sialyltransferase 5) participates in the biosynthesis of α-series gangliosides. It is linked with breast cancer metastasis to the brain. ST6GALNAC5 reduces the association between breast cancer cells and human blood brain barrier. Mutations in this gene are associated with coronary artery disease.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

ST6GALNAC5 Expression Decreases the Interactions between Breast Cancer Cells and the Human Blood-Brain Barrier.
Drolez A et al.
International Journal of Molecular Sciences, 17, E1309-E1309 (2016)
Kolsoum InanlooRahatloo et al.
Scientific reports, 4, 3595-3595 (2014-01-09)
We aimed to identify the genetic cause of coronary artery disease (CAD) in an Iranian pedigree. Genetic linkage analysis identified three loci with an LOD score of 2.2. Twelve sequence variations identified by exome sequencing were tested for segregation with

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique