Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU003621

Sigma-Aldrich

MISSION® esiRNA

targeting human WEE1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GATGTGCGACAGACTCCTCAAGTGAATATTAATCCTTTTACTCCGGATTCTTTGTTGCTTCATTCCTCAGGACAGTGTCGTCGTAGAAAGAGAACGTATTGGAATGATTCCTGTGGTGAAGACATGGAAGCCAGTGATTATGAGCTTGAAGATGAAACAAGACCTGCTAAGAGAATTACAATTACTGAAAGCAATATGAAGTCCCGGTATACAACAGAATTTCATGAGCTAGAGAAAATCGGCTCTGGAGAATTTGGTTCTGTATTTAAGTGTGTGAAGAGGCTGGATGGATGCATTTATGCCATTAAGCGATCAAAAAAGCCATTGGCGGGCTCTGTTGATGAGCAGAACGCTTTGAGAGAAGTATATGCTCATGCAGTGCTTGGACAGCATTCTCATGTAGTTCGATATTTCTCTGCGTGGGCAGAAGATGATCATATGCTTATACAGAATGAATATTGTAATGGTGGAAGTTTAGCTGATGCTATAAGTGAAAACTACAGAATCATGAGTTACTTTAAAGAAGCAGAGTTGAAGGATCTCCTTTTGCAAGTTGGC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Nupam P Mahajan et al.
Oncotarget, 8(63), 106352-106368 (2018-01-02)
Epigenetic signaling networks dynamically regulate gene expression to maintain cellular homeostasis. Previously, we uncovered that WEE1 phosphorylates histone H2B at tyrosine 37 (pY37-H2B) to negatively regulate global histone transcriptional output. Although pY37-H2B is readily detected in cancer cells, its functional
Ana Slipicevic et al.
Gynecologic oncology, 135(1), 118-124 (2014-08-06)
Wee1-like kinase (Wee1) is a tyrosine kinase which negatively regulates entry into mitosis at the G2 to M-phase transition and has a role in inhibition of unscheduled DNA replication in S-phase. The present study investigated the clinical role of Wee1
Koji Hatano et al.
Nucleic acids research, 43(8), 4075-4086 (2015-04-08)
MicroRNAs (miRNAs) have been implicated in DNA repair pathways through transcriptional responses to DNA damaging agents or through predicted miRNA regulation of DNA repair genes. We hypothesized that additional DNA damage regulating miRNAs could be identified by screening a library
Gry Irene Magnussen et al.
BMC cancer, 15, 462-462 (2015-06-10)
Malignant melanoma has an increasing incidence rate and the metastatic disease is notoriously resistant to standard chemotherapy. Loss of cell cycle checkpoints is frequently found in many cancer types and makes the cells reliant on compensatory mechanisms to control progression.

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique