Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

Autres documents

EHU002721

Sigma-Aldrich

MISSION® esiRNA

targeting human ERN1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CACAGTGACGCTTCCTGAAACCTTGTTGTTTGTGTCAACGCTGGATGGAAGTTTGCATGCTGTCAGCAAGAGGACAGGCTCAATCAAATGGACTTTAAAAGAAGATCCAGTCCTGCAGGTCCCAACACATGTGGAAGAGCCTGCCTTTCTCCCAGATCCTAATGATGGCAGCCTGTATACGCTTGGAAGCAAGAATAATGAAGGCCTGACGAAACTTCCTTTTACCATCCCAGAATTGGTGCAGGCATCCCCATGCCGAAGTTCAGATGGAATCCTCTACATGGGTAAAAAGCAGGACATCTGGTATGTTATTGACCTCCTGACCGGAGAGAAGCAGCAGACTTTGTCATCGGCCTTTGCAGATAGTCTCTGCCCATCAACCTCTCTTCTGTATCTTGGGCGAACAGAATACACCATCACCATGTACGACACCAAAACCCGAGAGCTCCGGTGGAATGCCACCTACTTTGACTATGCGGCCTCACTGCCTGAGGACGACGTGGACTACAAGATGTCCCACTTTGTGTCCAATGGTGATGGGCTGGTGGTGACTGTGGACAGT

Numéro d'accès Ensembl | humain

ENSG00000178607

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ERN1(2081) , ERN1(2081)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Qun Lai et al.
Yonsei medical journal, 54(6), 1407-1415 (2013-10-22)
To investigate the anti-apoptotic mechanism of leptin in non-small cell lung cancer. The influences of leptin on apoptosis were investigated, analyzing the mechanism that triggers growth of A549 cells. The effects of leptin on cell proliferation were examined by XTT
Antonello Storniolo et al.
Oxidative medicine and cellular longevity, 2015, 645157-645157 (2015-04-30)
Relative to their normal counterparts, tumor cells generally exhibit a greater "stress phenotype" and express heat shock proteins (Hsp) that represent candidate targets for anticancer therapy. Here we investigated the role of Hsp70 in survival induced by endoplasmic reticulum (ER)
Xun Yuan et al.
Oncotarget, 8(13), 21626-21638 (2017-04-21)
ONC201 was previously identified as a first-in-class antitumor agent and small-molecule inducer of the TRAIL (tumor necrosis factor-related apoptosis-inducing ligand) gene that induces apoptosis in cancer cells. ONC201 has a safety profile and is currently in phase II clinical trials
Amanda Crider et al.
Molecular neurobiology, 55(9), 7606-7618 (2018-02-13)
Impaired social interaction is a key feature of several major psychiatric disorders including depression, autism, and schizophrenia. While, anatomically, the prefrontal cortex (PFC) is known as a key regulator of social behavior, little is known about the cellular mechanisms that
K W Kim et al.
Oncogene, 29(22), 3241-3251 (2010-03-30)
As apoptosis defects limit efficacy of anticancer agents, autophagy has been proposed as a novel strategy for radiotherapy enhancement. We previously showed that caspase-3/7 inhibition induces autophagy and promotes radiosensitivity in vitro and in vivo. Therefore, we further investigated the
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique