Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EMU153561

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Kcnh8

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGCCGAGCCGTCCTTTATCACATCTCAGGACACCTTCAAAGAAGAGAAAAGAACAAATTGAAAATAAATAATAACGTGTTTGTAGATAAACCAGCGTTTCCAGAGTATAAGGTTTCTGATGCAAAAAAGTCCAAGTTCATCCTGCTGCATTTCAGCACTTTCAAAGCTGGCTGGGACTGGCTCATTTTGCTGGCAACGTTTTATGTTGCTGTGACAGTCCCTTACAATGTGTGTTTCATTGGCAATGAGGACCTGTCCACCACTCGGAGCACAACGGTCAGTGACATTGCAGTGGAGATACTGTTCATTATAGCAGATATTATTCTAAATTTCCGAACAACTTATGTCAGCAAGTCTGGCCAAGTTATCTTTGAAGCGAGATCCATTTGCATTCACTACGTCACCACCTGGTTCATCATTGATCTGATTGCTGCCTTGCCCTTTGACCTCCTGTATGCTTTCAATGTCACAGTGGTGTCCCTCGTTCATCTCCTGAAGACTGTTCGGCT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Velidi H Rao et al.
American journal of physiology. Heart and circulatory physiology, 309(6), H1075-H1086 (2015-08-09)
Although degradation of extracellular matrix by matrix metalloproteinases (MMPs) is thought to be involved in symptomatic (S) carotid plaques in atherosclerosis, the mechanisms of MMP expression are poorly understood. Here, we demonstrate that collagen loss in vascular smooth vessel cells
E Douglas Robertson et al.
PloS one, 9(11), e113050-e113050 (2014-11-18)
The molecular response to hypoxia is a critical cellular process implicated in cancer, and a target for drug development. The activity of the major player, HIF1α, is regulated at different levels by various factors, including the transcription factor ELK3. The

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service