Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EMU039811

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Irak1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGATTGGAGAGGGTGGTTTTGGATGTGTGTACCGAGCAGTCATGAGAAATACTACATATGCTGTGAAGAGACTGAAGGAGGAAGCTGACCTAGAGTGGACTATGGTGAAACAGAGCTTCTTAACAGAGGTGGAACAGCTATCAAGGTTTCGTCACCCAAATATCGTAGACTTTGCTGGCTACTGTGCAGAGAGTGGCTTATACTGCCTTGTTTATGGCTTCTTGCCCAATGGCTCCTTGGAGGATCAGCTCCACCTTCAGACCCAGGCCTGCTCCCCACTTTCCTGGCCTCAACGACTGGACATTCTTCTGGGCACAGCCCGGGCTATTCAGTTTTTACATCAGGATAGCCCCAGCCTTATCCATGGAGACATCAAGAGTTCTAACGTGCTTCTGGATGAGAGACTGATGCCCAAGCTGGGAGACTTTGGCCTGGCTCGTTTCAGCCGCTTTGCGGGGGCCAAAGCAAGCCAGAGCAGTACTGTGGCCCGGACTTCCACAGTTCGAGGTACCC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

12 - Non Combustible Liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Florian Meisgen et al.
The Journal of investigative dermatology, 134(7), 1931-1940 (2014-03-29)
Keratinocytes represent the first line of defense against pathogens in the skin and have important roles in initiating and regulating inflammation during infection and autoimmunity. Here we investigated the role of miR-146a in the regulation of the innate immune response
Zhen Ning Wee et al.
Nature communications, 6, 8746-8746 (2015-10-28)
Metastatic tumour recurrence due to failed treatments remains a major challenge of breast cancer clinical management. Here we report that interleukin-1 receptor-associated kinase 1 (IRAK1) is overexpressed in a subset of breast cancers, in particular triple-negative breast cancer (TNBC), where

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service