Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EMU037461

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Bcl2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGCAAATGCTGGACTGAAAAATTGTAATTCATCTGCCGCCGCCGCCGCTGCCTTTTTGCCCCGCTGCGGTGCTCTTGAGATCTCTGGTTGGGATTCCTACGGATTGACATTCTCAGTGAAGCCGGAGTGTGAGGACCCAATCTGGAAACCCTCCTGATTTTTCCTCCACCTAGCCCCCAGACCCCAACTCCCGATTCATTGCAAGTTGTAAAGAAGCTTATACAAGGAGACTTCTGAAGATCGATGGTGTGGTTGCCTTATGTATTTGTTTGGGTTTTACCAAAAAAGGGTAAACTTGACAGAAGATCATGCCGTCCTTAGAAAATACAGCATTGCGGAGGAAGTAGACTGATATTAACAAAGCTTAATAAATAATGTACCTCATGAAATAAAAAGCAGAAAGGAATTTGAATAAAAATTTCCTGCATCTCATGCCAACGGGGAAACACCAGAATCAAGTGTTCGGTGTAACTAAAGACACCCCTTCATCCAAGAA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xi-Mei Wang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 37(5), 1914-1926 (2015-11-20)
Dipeptidyl peptidase-4 (DPP-4) inhibitors have pleiotropic effects on cardiovascular protection beyond the antidiabetic property. However, it remains unknown that the impact of one DPP-4 inhibitor sitagliptin on the survival of mesenchymal stem cells (MSCs) in hypoxia and serum deprivation (H/SD)
Qingmin Wang et al.
PloS one, 9(7), e100949-e100949 (2014-07-08)
MPT64 is one of the secreted proteins from Mycobacterium tuberculosis. Little is known about its role in infection by Mycobacterium tuberculosis. In this study, we demonstrated that MPT64 could dose-dependently inhibit the apoptosis of RAW264.7 macrophages induced by PPD-BCG. Quantitative
N Bah et al.
Cell death & disease, 5, e1291-e1291 (2014-06-13)
Antimitotic agents such as microtubule inhibitors (paclitaxel) are widely used in cancer therapy while new agents blocking mitosis onset are currently in development. All these agents impose a prolonged mitotic arrest in cancer cells that relies on sustained activation of
Yang Zhou et al.
Journal of cell science, 127(Pt 20), 4494-4506 (2014-08-12)
Tubular epithelial cell apoptosis contributes to tubulointerstitial fibrosis but its regulation remains unclear. Here, in fibrotic kidney induced by unilateral ureteral obstruction (UUO), we demonstrate that miR-34a is markedly upregulated in tubulointerstitial spaces and microvesicles isolated from obstructed kidney. However
Caina Xu et al.
Small (Weinheim an der Bergstrasse, Germany), 11(34), 4321-4333 (2015-07-03)
A pulmonary codelivery system that can simultaneously deliver doxorubicin (DOX) and Bcl2 siRNA to the lungs provides a promising local treatment strategy for lung cancers. In this study, DOX is conjugated onto polyethylenimine (PEI) by using cis-aconitic anhydride (CA, a

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service