Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EMU031941

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mmp3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGATCGATGCTGCCATTTCTAATAAAGAGAAAAGGAAGACCTACTTCTTTGTAGAGGACAAATACTGGAGGTTTGATGAGAAGAAACAATCCATGGAGCCAGGATTTCCCAGGAAGATAGCTGAGGACTTTCCAGGTGTTGACTCAAGGGTGGATGCTGTCTTTGAAGCATTTGGGTTTCTCTACTTCTTCAGTGGATCTTCGCAGTTGGAATTTGACCCAAATGCCAAAAAAGTGACCCACATATTGAAGAGCAATAGCTGGTTTAATTGTTAAAAAGAGATCCAAGGAAGGCATCCTGTGTTTTAACTGATGCTTATAGTTCTTCATCTGAGTCTTTGTGAAAGGAAGTGCTTTGTTCAGCATGTGCTATGGCAGAACCAAACAGGAGCTATGGATGACACCAGTCAACGTCAAGTTGTCAAAGGATGTTCAGAAGCACTGTGTAGCTTACACTGTGTCCCAAGGAGAGGAG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Nobuaki Ozeki et al.
Bioscience trends, 9(3), 160-168 (2015-07-15)
Although it is known that inorganic polyphosphate [Poly(P)] induces differentiation of osteoblasts, there are few reports concerning its effects on cell proliferation, especially in fibroblasts. Because we found that Poly(P) stimulates the proliferation of purified rat dental pulp fibroblast-like cells
Jee Youn Lee et al.
The American journal of pathology, 184(11), 2985-3000 (2014-10-19)
After spinal cord injury (SCI), blood-spinal cord barrier (BSCB) disruption by matrix metalloproteinases (MMPs) leads to BSCB permeability and blood cell infiltration, contributing to permanent neurological disability. Herein, we report that MMP-3 plays a critical role in BSCB disruption after
Debarati Banik et al.
Oncotarget, 6(17), 15164-15179 (2015-05-27)
Interferon regulatory factor-8 (IRF8), originally identified as a leukemic tumor suppressor, can also exert anti-neoplastic activities in solid tumors. We previously showed that IRF8-loss enhanced tumor growth, which was accompanied by reduced tumor-cell susceptibility to apoptosis. However, the impact of
N Ozeki et al.
Oral diseases, 20(5), 505-513 (2013-08-02)
Matrix metalloproteinase (MMP)-3 expression increases after pulpectomy and accelerates angiogenesis in rat dental pulp by an uncharacterised mechanism. Odontoblasts, a major component of dental pulp, could represent a therapeutic target. We investigated whether MMP-3 activity is induced by cytokines and/or

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service