Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU139501

Sigma-Aldrich

MISSION® esiRNA

targeting human RETN

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTCTCCTCCTCCTCCCTGTCCTGGGGCTGTTGGTGTCTAGCAAGACCCTGTGCTCCATGGAAGAAGCCATCAATGAGAGGATCCAGGAGGTCGCCGGCTCCCTAATATTTAGGGCAATAAGCAGCATTGGCCTGGAGTGCCAGAGCGTCACCTCCAGGGGGGACCTGGCTACTTGCCCCCGAGGCTTCGCCGTCACCGGCTGCACTTGTGGCTCCGCCTGTGGCTCGTGGGATGTGCGCGCCGAGACCACATGTCACTGCCAGTGCGCGGGCATGGACTGGACCGGAGCGCGCTGCTGTCGTGTGCAGCCCTGAGGTCGCGCGCAGCGCGTGCACAGCGCGGGCGGAGGCGGCTCCAGGTCCGGAGGGGTTGCGGGGGAGCTGGAAATAAACCTGGAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Kou-Gi Shyu et al.
Journal of biomedical science, 16, 50-50 (2009-05-29)
Atorvastatin has been shown to reduce resistin expression in macrophages after pro-inflammatory stimulation. However, the mechanism of reducing resistin expression by atorvastatin is not known. Therefore, we sought to investigate the molecular mechanisms of atorvastatin for reducing resistin expression after
Yoshito Ikeda et al.
Biochemical and biophysical research communications, 448(2), 129-133 (2014-03-29)
Resistin and plasminogen activator inhibitor-1 (PAI-1) are adipokines, which are secreted from adipocytes. Increased plasma resistin and PAI-1 levels aggravate metabolic syndrome through exacerbation of insulin resistance and induction of chronic inflammation. However, the relationship between resistin and PAI-1 gene

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service