Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU125211

Sigma-Aldrich

MISSION® esiRNA

targeting human SCARB1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGTGGGTGAGATCATGTGGGGCTACAAGGACCCCCTTGTGAATCTCATCAACAAGTACTTTCCAGGCATGTTCCCCTTCAAGGACAAGTTCGGATTATTTGCTGAGCTCAACAACTCCGACTCTGGGCTCTTCACGGTGTTCACGGGGGTCCAGAACATCAGCAGGATCCACCTCGTGGACAAGTGGAACGGGCTGAGCAAGGTTGACTTCTGGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Vasily Sukhorukov et al.
Biochimica et biophysica acta. Molecular and cell biology of lipids, 1864(5), 643-653 (2019-01-15)
Human plasma lipoproteins are known to contain various glycan structures whose composition and functional importance are starting to be recognized. We assessed N-glycosylation of human plasma HDL and LDL and the role of their glycomes in cellular cholesterol metabolism. N-glycomic
Ilaria Crivellari et al.
Free radical biology & medicine, 102, 47-56 (2016-11-21)
For its critical location, the skin represents the major interface between the body and the environment, therefore is one of the major biological barriers against the outdoor environmental stressors. Among the several oxidative environmental stressors, cigarette smoke (CS) has been
Rene Raphemot et al.
Cell chemical biology, 26(9), 1253-1262 (2019-07-02)
Plasmodium parasites undergo an obligatory and asymptomatic developmental stage within the liver before infecting red blood cells to cause malaria. The hijacked host pathways critical to parasite infection during this hepatic phase remain poorly understood. Here, we implemented a forward
Zhou-Yi Wu et al.
European journal of pharmacology, 853, 111-120 (2019-03-25)
Farnesoid X receptor (FXR) agonists play important regulatory roles in bile acid, lipid and glucose metabolism in vitro and in vivo. Thus, FXR agonists exhibit potential therapeutic effects on metabolism-related diseases that are associated with extrahepatic manifestations induced by hepatitis
Shudi Tang et al.
Scientific reports, 9(1), 1350-1350 (2019-02-06)
Therapeutic interventions that increase plasma high density lipoprotein (HDL) and apolipoprotein (apo) A-I levels have been reported to reduce plasma glucose levels and attenuate insulin resistance. The present study asks if this is a direct effect of increased glucose uptake

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service