Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU122481

Sigma-Aldrich

MISSION® esiRNA

targeting human NANOS2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGAAGGACTACTTCAACCTGAGCCAGGTGGTGTGGGCGCTGATCGCAAGTCGGGGTCAAAGGCTGGAGACCCAAGAGATTGAGGAGCCAAGTCCCGGGCCTCCGCTGGGGCAGGATCAGGGGCTGGGGGCGCCAGGGGCCAACGGGGGCCTGGGGACCCTGTGCAACTTCTGCAAGCACAACGGGGAGTCCCGCCACGTCTACTCCTCACACCAGCTGAAGACACCGGATGGCGTGGTGGTGTGTCCCATCCTGAGGCACTACGTGTGTCCCGTGTGCGGGGCCACCGGTGACCAGGCCCATACGCTCAAGTACTGCCCGCTTAACGGTGGCCAGCAGTCCCTCTACCGCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Plinio C Casarotto et al.
PeerJ, 6, e4635-e4635 (2018-04-24)
Trichotillomania (TTM) is an impulse control disorder characterized by repetitive hair pulling/trimming. Barbering behavior (BB) observed in laboratory animals is proposed as a model of TTM. The neurobiological basis of TTM is unclear, but involves striatal hyperactivity and hypoactivation of
Laura M López-Sánchez et al.
Laboratory investigation; a journal of technical methods and pathology, 101(3), 292-303 (2020-12-03)
Cancer stem cells (CSCs) are involved in the resistance of estrogen (ER)-positive breast tumors against endocrine therapy. On the other hand, nitric oxide (NO) plays a relevant role in CSC biology, although there are no studies addressing how this important
Huan Liu et al.
Microbiology and immunology, 62(9), 594-606 (2018-07-12)
Transcriptional regulation of inducible nitric oxide synthase (iNOS) is critically involved in the pathogenesis and progression of rheumatoid arthritis (RA); however, the specific transcription factors that control this process remain largely unidentified. In the present study, it was discovered that

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service