Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU121701

Sigma-Aldrich

MISSION® esiRNA

targeting human RRM2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGTGATTTTGCTTGCCTGATGTTCAAACACCTGGTACACAAACCATCGGAGGAGAGAGTAAGAGAAATAATTATCAATGCTGTTCGGATAGAACAGGAGTTCCTCACTGAGGCCTTGCCTGTGAAGCTCATTGGGATGAATTGCACTCTAATGAAGCAATACATTGAGTTTGTGGCAGACAGACTTATGCTGGAACTGGGTTTTAGCAAGGTTTTCAGAGTAGAGAACCCATTTGACTTTATGGAGAATATTTCACTGGAAGGAAAGACTAACTTCTTTGAGAAGAGAGTAGGCGAGTATCAGAGGATGGGAGTGATGTCAAGTCCAACAGAGAATTCTTTTACCTTGGATGCTGACTTCTAAATGAACTGAAGATGTGCCCTTACTTGGCTGATTTTTTTTTTCCATCTCATAAGAAAAATCAGCTGAAGTGTTACCAACTAGCCACACCATGAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yueting Wu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 103, 982-988 (2018-05-02)
Peripheral vascular disease (PVD) is a prevalent vascular disease that affect a large number of patients. The establishment of optimal treatments to mitigate the intimal hyperplasia (IH)-induced restenosis would help relieve the health burden of the PVD. Ribonucleotide reductase M2
S M Du
Neoplasma, 67(3), 567-575 (2020-03-04)
Long noncoding RNAs (lncRNAs) have been suggested to play vital roles in tumor initiation and progression. Recent studies have reported that the lncRNA small nucleolar RNA host gene 16 (SNHG16) is highly expressed in breast cancer tissue. In the present
Zejun Fang et al.
Oncotarget, 7(47), 78055-78068 (2016-11-02)
As the small subunit of Ribonucleotide reductase (RR), RRM2 displays a very important role in various critical cellular processes such as cell proliferation, DNA repair, and senescence, etc. Importantly, RRM2 functions like a tumor driver in most types of cancer
Wei Kang et al.
Oncology reports, 31(6), 2579-2586 (2014-04-24)
Ribonucleotide reductase M2 subunit (RRM2) is one of the two subunits of human ribonucleotide reductase which plays a critical role in tumor progression. The aim of the present study was to analyze its expression, clinical significance and biological functions in gastric
Chunshui Liu et al.
Oncology reports, 42(2), 571-580 (2019-06-25)
Imatinib‑based targeted treatment is the standard therapy for chronic myeloid leukemia (CML); however, drug resistance is an inevitable issue for imatinib‑based CML treatment. Imatinib resistance can be ascribed to Bcr‑Abl‑dependent and independent resistance. In the present study, peripheral blood samples

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service