Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU116361

Sigma-Aldrich

MISSION® esiRNA

targeting human TRPC6

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGCCCAGAGCATCATTGACGCAAATGATACTTTGAAGGACTTGACGAAAGTAACATTGGGAGACAATGTGAAATACTACAATTTGGCCAGGATAAAGTGGGACCCCTCTGATCCTCAAATAATATCTGAAGGTCTTTATGCAATTGCTGTAGTTTTAAGTTTCTCTAGGATAGCTTATATTTTACCAGCAAATGAAAGCTTTGGACCTCTGCAGATATCACTTGGAAGAACAGTCAAAGACATCTTCAAGTTCATGGTCATATTCATTATGGTGTTTGTGGCCTTTATGATTGGAATGTTCAATCTCTACTCCTACTACATTGGTGCAAAACAAAATGAAGCCTTCACAACAGTTGAAGAGAGTTTTAAGACACTGTTCTGGGCTATATTTGGACTTTCTGAAGTGAAATCAGTGGTCATCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Liang Wen et al.
Scientific reports, 6, 23269-23269 (2016-03-25)
Hepatocellular carcinoma (HCC) is notoriously refractory to chemotherapy because of its tendency to develop multi-drug resistance (MDR), whose various underlying mechanisms make it difficult to target. The calcium signalling pathway is associated with many cellular biological activities, and is also
Navin K Kapur et al.
Journal of the American Heart Association, 3(4) (2014-07-13)
Right ventricular (RV) failure is a major cause of mortality worldwide and is often a consequence of RV pressure overload (RVPO). Endoglin is a coreceptor for the profibrogenic cytokine, transforming growth factor beta 1 (TGF-β1). TGF-β1 signaling by the canonical
Hitesh Soni et al.
Scientific reports, 6, 29041-29041 (2016-07-08)
Glomerular mesangial cell (GMC) proliferation and death are involved in the pathogenesis of glomerular disorders. The mechanisms that control GMC survival are poorly understood, but may include signal transduction pathways that are modulated by changes in intracellular Ca(2+) ([Ca(2+)]i) concentration.
Haiyang Tang et al.
American journal of physiology. Lung cellular and molecular physiology, 310(9), L846-L859 (2016-03-13)
An increase in cytosolic free Ca(2+) concentration ([Ca(2+)]cyt) in pulmonary arterial smooth muscle cells (PASMC) is a major trigger for pulmonary vasoconstriction and a critical stimulation for PASMC proliferation and migration. Previously, we demonstrated that expression and function of calcium
Kazuo Murakami et al.
Fundamental & clinical pharmacology, 31(4), 383-391 (2017-01-21)
We reported that coronary spasm was induced in the transgenic mice with the increased phospholipase C (PLC)-δ1 activity. We investigated the effect of enhanced PLC-δ1 on Ca

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service