Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU095101

Sigma-Aldrich

MISSION® esiRNA

targeting human NRG1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACCATCACCCTCAGCAGTTCAGCTCCTTCCACCACAACCCCGCGCATGACAGTAACAGCCTCCCTGCTAGCCCCTTGAGGATAGTGGAGGATGAGGAGTATGAAACGACCCAAGAGTACGAGCCAGCCCAAGAGCCTGTTAAGAAACTCGCCAATAGCCGGCGGGCCAAAAGAACCAAGCCCAATGGCCACATTGCTAACAGATTGGAAGTGGACAGCAACACAAGCTCCCAGAGCAGTAACTCAGAGAGTGAAACAGAAGATGAAAGAGTAGGTGAAGATACGCCTTTCCTGGGCATACAGAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Youya Wang et al.
Journal of thoracic disease, 10(6), 3166-3179 (2018-08-03)
Neuregulin1 (NRG1) is critical signaling protein that mediates the activation of downstream signaling pathways associated with malignancies. Multiple gene fusions related to NRG1 have been found in lung cancer. However, the underlying role NRG1 in lung cancer is yet unclear.
K Yonesaka et al.
Oncogene, 35(7), 878-886 (2015-05-12)
Human epidermal growth factor receptor (HER) 3 is aberrantly overexpressed and correlates with poor prognosis in non-small cell lung cancer (NSCLC). Patritumab is a monoclonal antibody against HER3 that has shown promising results in early-phase clinical trials, but an optimal
Alessandra Bolino et al.
EMBO molecular medicine, 8(12), 1438-1454 (2016-11-02)
Charcot-Marie-Tooth (CMT) neuropathies are highly heterogeneous disorders caused by mutations in more than 70 genes, with no available treatment. Thus, it is difficult to envisage a single suitable treatment for all pathogenetic mechanisms. Axonal Neuregulin 1 (Nrg1) type III drives

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service