Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU093651

Sigma-Aldrich

MISSION® esiRNA

targeting human SUV39H2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGAGCTGTGACTTGCAGAGGTTACCTCAACTGAACTTTTTCAGGAAATAGAGCTGATGATTATAATATTTTTTTCCTAATGTTAACATTTTTAAAAATACATATTTGGGACTCTTATTATCAAGGTTCTACCTATGTTAATTTACAATTCATGTTTCAAGACATTTGCCAAATGTATTACCGATGCCTCTGAAAAGGGGGTCACTGGGTCTCATAGACTGATATGAAGTCGACATATTTATAGTGCTTAGAGACCAAACTAATGGAAGGCAGACTATTTACAGCTTAGTATATGTGTACTTAAGTCTATGTGAACAGAGAAATGCCTCCCGTAGTGTTTGAAAGCGTTAAGCTGATAATGTAATTAACAACTGCTGAGAGATCAAAGATTCAACTTGCCATACACCTCAAATTCGGAGAAACA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yue Zhang et al.
Journal of molecular cell biology, 11(9), 761-769 (2018-12-12)
X chromosome inactivation and genomic imprinting are two classic epigenetic regulatory processes that cause mono-allelic gene expression. In female mammals, mono-allelic expression of the long non-coding RNA gene X-inactive specific transcript (XIST) is essential for initiation of X chromosome inactivation
Wendi Shuai et al.
Cancer letters, 422, 56-69 (2018-02-20)
Suppressor of variegation 3-9 homolog 2 (SUV39H2) is a member of the SUV39H subfamily of lysine methyltransferases. Its role in colorectal cancer (CRC) proliferation and metastasis has remained unexplored. Here, we determined that SUV39H2 was upregulated in CRC tissues compared
Emily B Askew et al.
Molecular and cellular endocrinology, 443, 42-51 (2017-01-04)
Androgen receptor (AR) transcriptional activity depends on interactions between the AR NH
Oriane Mauger et al.
Nucleic acids research, 43(3), 1869-1882 (2015-01-22)
Alternative splicing is the main source of proteome diversity. Here, we have investigated how alternative splicing affects the function of two human histone methyltransferases (HMTase): G9A and SUV39H2. We show that exon 10 in G9A and exon 3 in SUV39H2

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service