Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU090451

Sigma-Aldrich

MISSION® esiRNA

targeting human NDEL1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGAAACTGCTTATTGGAAGGAACTTTCCTTGAAGTATAAGCAAAGCTTCCAGGAAGCTCGGGATGAGCTAGTTGAATTCCAGGAAGGAAGCAGAGAATTAGAAGCAGAGTTGGAGGCACAATTAGTACAGGCTGAACAAAGAAATAGAGACTTGCAGGCTGATAACCAAAGACTGAAATATGAAGTGGAGGCATTAAAGGAGAAGCTAGAGCATCAATATGCACAGAGCTATAAGCAGGTCTCAGTGTTAGAAGATGATTTAAGTCAGACTCGGGCCATTAAGGAGCAGTTGCATAAGTATGTGAGAGAGCTGGAGCAGGCCAACGACGACCTGGAGCGAGCCAAAAGGGCAACAATAGTTTCACTGGAAGACTTTGAACAAAGGCTAAACCAGGCCATT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Cory Toth et al.
PloS one, 3(4), e2014-e2014 (2008-04-24)
Failure of axons to regenerate following acute or chronic neuronal injury is attributed to both the inhibitory glial environment and deficient intrinsic ability to re-grow. However, the underlying mechanisms of the latter remain unclear. In this study, we have investigated
Mathieu Chansard et al.
PloS one, 6(1), e14583-e14583 (2011-02-02)
Cytoskeleton dynamics, membranes trafficking and positioning are essential for the proper functioning of any mammalian cell. The identification of the molecules and mechanisms that allow these cellular processes to interface is vital for understanding cell behaviors. Ndel1, the mammalian homolog

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service