Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU082311

Sigma-Aldrich

MISSION® esiRNA

targeting human AMACR, C1QTNF3-AMACR

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCATGGAAACATGGAGGAACAGTATTACAGTGTCCTACCACTCTAATCAAGAAAAGAATTACAGACTCTGATTCTACAGTGATGATTGAATTCTAAAAATGGTTATCATTAGGGCTTTTGATTTATAAAACTTTGGGTACTTATACTAAATTATGGTAGTTATTCTGCCTTCCAGTTTGCTTGATATATTTGTTGATATTAAGATTCTTGACTTATATTTTGAATGGGTTCTAGTGAAAAAGGAATGATATATTCTTGAAGACATCGATATACATTTATTTACACTCTTGATTCTACAATGTAGAAAATGAGGAAATGCCACAAATTGTATGGTGATAAAAGTCACGTGAAACAGAGTGATTGGTTGCATCCAGGCCTTTTGTCTTGGTGTTCATGATCTCCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Lei Chen et al.
Inflammation, 42(4), 1350-1359 (2019-03-20)
C1q/tumor necrosis factor-related protein-3 (CTRP3) is a novel, certified, adipokine that beneficially regulates metabolism and inflammation in the cardiovascular system. Atherosclerotic plaque rupturing and secondary thrombosis cause vascular disorders, such as myocardial infarction and unstable angina. However, the underlying role
Daniel W Youngstrom et al.
Journal of orthopaedic research : official publication of the Orthopaedic Research Society, 38(5), 996-1006 (2019-12-07)
C1q/TNF-related protein 3 (CTRP3) is a cytokine known to regulate a variety of metabolic processes. Though previously undescribed in the context of bone regeneration, high throughput gene expression experiments in mice identified CTRP3 as one of the most highly upregulated

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service